Главная \ 3. Пробиотики \ Микрофлора ЖКТ \ Короткоцепочечные жирные кислоты и пробиотики \ Пропионовая кислота и пропионаты \ Пропионовая кислота противодействует воспалению подкожно-жировой клетчатки человека

Пропионовая кислота против воспаления подкожного жира

Пропионовая кислота противодействует воспалению подкожно-жировой клетчатки человека

воспаление подкожной жировой ткани

Предисловие редактора

В данном разделе речь пойдет о воспалении жировой ткани и противовоспалительном действии пропионовой кислоты, снимающем пагубные эффекты воспаления подкожно-жировой клетчатки. Известно, что пищевая композиция, содержащая молочные пропионовокислые бактерии P. freudenreichii, выбранные на основании их незначительной приверженности автолизу, а также их устойчивости к воздействию желчных солей, способна оказывать значительное стимулирующее и усиливающее воздействие на синтез пропионовой кислоты в кишечнике путем бактериальной анаэробной ферментации пищевых волокон при условии перорального введения в организм адекватного количества биомассы указанных пробиотических микроорганизмов. Прежде чем раскрыть вопрос антивоспалительного действия пропионовой кислоты, стоит кратко рассмотреть общую информацию о воспалении в контексте ожирения.

num-1_color

ВОСПАЛЕНИЕ И ОЖИРЕНИЕ

Очень важно понимать, что жировая ткань является не только органом хранения и изоляции жира, но и эндокринной тканью (способной производить большое разнообразие молекул), которая связана с другими клетками и имеет тесные и сложные отношения с иммунной системой. Дисбаланс в гомеостазе, гиперплазия и перепроизводство адипокинов приводят к патологическим состояниям, таким как ожирение и воспаление жировой ткани, которые могут развивать инсулинорезистентность и способствовать патогенезу сахарного диабета 2 типа.

Ожирение - это заболевание, оказывающее серьезное негативное воздействие на здоровье, главным образом вызванное рядом экологических, гуморальных и генетических факторов. Существуют гены, обладающие высокой способностью индуцировать состояние ожирения. Среди них есть те, которые регулируют потребление и насыщение, такие как ген лептина или его рецептор, изменения в гене проопиомеланокортина или в рецепторе меланокортина-4, мутации в некоторых из этих генов могут вызывать ожирение [1]. С другой стороны, исследования последних лет предполагают участие воспалительных путей и повышение уровня провоспалительных цитокинов, таких как ядерный фактор (NF)-kB, приводящее к увеличению IL-6, TNF-α и IL-1β [2], что способствует развитию ожирения и ассоциированной с ожирением инсулинорезистентности, поскольку воспаление вызывает значительное ухудшение сигнальных путей инсулина и лептина. [2, 3, 4, 5].

Изменение метаболического синдрома вследствие ожирения является одним из наиболее распространенных факторов, которые вызывают активацию воспаления, вызывая другие изменения, такие как окисление, клеточная гипертрофия и стресс, среди прочих [6].

Метаболическая и иммунная системы регулируются между собой и состоят из гормонов, цитокинов, сигнальных белков, факторов транскрипции и биологически активных липидов. Поэтому основной воспалительный ответ способствует катаболическому состоянию и подавляет анаболические пути, такие как высококонсервативный и мощный путь передачи сигналов инсулина [6, 7].

Ожирение вызывает увеличение и расширение жировой ткани и молекулярно индуцирует высвобождение сигналов и белковых медиаторов, называемых адипокинами. Воспалительный ответ обусловлен высокой продукцией адипокинов, которые вызывают высвобождение медиаторов воспаления, таких как лептин, адипонектин, TNF-α, IL-1β, IL-6, хемотаксический белок моноцитов MCP-1, фактор, ингибирующий миграцию макрофагов (MIF), NGF, VEGF, ингибитор активатора плазминогена PAI-1 и гаптоглобин [2]. Несколько исследований показали экспрессию этих провоспалительных медиаторов (в основном, TNF-α и IL-1β) в метаболических изменениях [3].

Увеличение доказательств в исследованиях человеческой популяции и исследований на животных установило причинные связи таких заболеваний, как резистентность к инсулину, СД2 и метаболический синдром в результате увеличения адипоцитов [3].

Исследование Haiyan Xu et al. продемонстрировали активную роль макрофагов в патологическом ожирении и их взаимосвязи с воспалительными процессами, заключив, что заболевание хроническим воспалением, инициируемое в жировой ткани, является следствием инсулинорезистентности [8, 9]. Хотя очевидно, что ингибирование сигнальных путей инсулинового рецептора является центральным механизмом, посредством которого воспалительные и стрессовые реакции опосредуют резистентность к инсулину, вероятно, что другие пути, молекулы и белки еще не были обнаружены с альтернативным механизмом, вовлеченным в это взаимодействие. [9, 10].

Последние исследования показывают, что основной риск развития метаболического осложнения - это инсулинорезистентность. Однако, помимо сердечно-сосудистых и гематологических заболеваний, такие патологии, как  жировая дистрофия печени, заболевания дыхательных путей, рак и др., повышают уровень липидов или цитокинов и, в свою очередь, развивают инсулинорезистентность при отсутствии ожирения [11].

Важно понимать воспалительные патогенные механизмы, которые вызывают заболевания при отсутствии или наличии ожирения. Цель состоит в том, чтобы снизить уровень заболеваемости и смертности путем предотвращения и лечения патологий, которые связывают воспаление с ожирением [3].

num-2_color

Пропионовая кислота противодействует воспалению подкожно-жировой клетчатки человека: новый путь развития лекарственных средств

Наиболее распространенные места  локализации панникулита
проявление целлюлита
Панникулит
Липодистрофия
Некоторые проявления воспаления подкожно-жировой ткани

Sa’ad Al-Lahham & Farhad Rezaee
Propionic acid counteracts the inflammation of human subcutaneous adipose tissue: a new avenue for drug development
DARU Journal of Pharmaceutical Sciences (2019) 27:645–652 

Резюме

Жировая ткань является основным местом индуцированного ожирением воспаления, которое становится важным фактором развития связанных с ожирением расстройств. Факторы, влияющие на индуцированное жировой тканью воспаление и возникающие в результате этого патофизиологические явления, остаются малоизученными. Однако потребление пищевых волокон, по-видимому, является защитным фактором. Короткоцепочечные жирные кислоты, такие как пропионовая кислота (PA), являются основными продуктами ферментации пищевых волокон микробиотой. Поэтому мы ставим своей целью исследовать влияние PA на воспаление, липогенез и маркеры поглощения глюкозы из подкожной жировой ткани человека SAT (рус. подкожной жировой клетчатки).

Пропионовая кислота Мы показали, что лечение SAT с применением PA приводит к значительному снижению регуляции воспалительных параметров (например, TNF-α и IP-10) и маркеров макрофагов (например, CD163 и MMP-9). Уровни экспрессии PA-рецепторов (*рецепторов, связанных с G-белком-41 и -43) в первичных адипоцитах человека были очень низкими по сравнению с SAT и макрофагами. При лечении PA в адипоцитах человека не наблюдалось никакого противовоспалительного эффекта. PA значительно повышали экспрессию липопротеиновой липазы (LPL), стероидного регуляторно-элементного связывающего белка-1С (SREBP-1c) и переносчика глюкозы 4 (GLUT-4), которые связаны с липогенезом и поглощением глюкозы. Мы также показали, что наблюдаемые противовоспалительные эффекты PA на SAT были частично опосредованы рецептором, связанным с белком Gi/o. Наши данные свидетельствуют о том, что противовоспалительные эффекты PA на SAT частично опосредованы белками Gi/o, что приводит к улучшению экспрессии факторов, связанных с липогенезом и поглощением глюкозы. Эти реакции, по-видимому, не были опосредованы адипоцитами; но, скорее всего, с помощью макрофагов. Нынешнее исследование дает новые знания, которые могут быть использованы в качестве потенциального нового направления для разработки лекарственных препаратов для предотвращения связанных с ожирением воспалительных процессов и метаболических нарушений.

Примечание ред.: *Упомянутые выше GPR41 и GPR43 представляют собой пару рецепторов, связанных с G-белками млекопитающих (GPCRs), экспрессируемых в адипоцитах человека, эпителиальных клетках толстой кишки и мононуклеарных клетках периферической крови (PBMC). Эти рецепторы активируются короткоцепочечными жирными кислотами (SCFAs), такими как ацетат, пропионат и бутират, которые вырабатываются во время ферментации пищевых волокон резидентными кишечными бактериями. Эта уникальная лигандная специфичность предполагает, что GPR41 и GPR43 могут опосредовать взаимодействие между человеческим хозяином и кишечным микробиомом.

Дополнительная иллюстрация к исследованию

shematicheskoe_predstavlenie_potoka_issledovanij.png

Схематическое представление потока исследований и составляющих его компонентов. В данном исследовании изучалось влияние пропионовой кислоты (PA) на воспаление в подкожной жировой ткани человека (SAT), первичных адипоцитах человека и экспрессию нескольких характерных воспалительных компонентов, продуцируемых SAT и адипоцитами человека.


ВСТУПЛЕНИЕ

Ожирение достигло масштабов эпидемии и по-прежнему растет тревожными темпами во всем мире. Всемирная организация здравоохранения сообщила, что население, проживающее на Земле, составляет примерно 7,77,7 миллиарда человек, из которых более 1,9 миллиарда взрослых (~39%) имеют избыточный вес и более 600 миллионов - ожирение (~13%) [1]. В Палестине было показано, что распространенность ожирения примерно в 4 раза среди женщин (49%) и в 2 раза среди мужчин (30%) превышает общемировую наблюдаемую распространенность [2].

Ожирение ассоциируется с хронической активацией низкодифференцированного воспаления [3], которое участвует в патогенезе ассоциированных с ожирением заболеваний, включая инсулинорезистентность, сахарный диабет 2-го типа (СД2) [4, 5] и сердечно-сосудистые заболевания [6, 7]. Этиология ожирения и низкопробного воспаления сложна и включает в себя внутренние и внешние факторы. В последнее время было показано, что специфические представители микробиоты у человека, в частности фирмикуты, ассоциируются с ожирением и сопутствующими ему недугами [8-11].

Кроме того, колонизация безмикробных мышей микробиотой, полученной от тучных мышей, приводит к значительно большему ожирению, чем колонизация микробиотой от худых мышей [12]. И наоборот, пребиотические диеты, такие как фруктаны [13], связаны с общим улучшением здоровья, включая снижение массы тела, жировой массы и тяжести СД2 [14-16]. Однако факторы, влияющие на состав и метаболизм кишечной микробиоты, а также ожирение и связанные с ним воспаление и патофизиология остаются в лучшем случае неясными.

Ферментация пищевых волокон / резистентного крахмала микробиотой толстой кишки является основным источником для производства короткоцепочечных жирных кислот (SCFAs), в частности уксусной, масляной и пропионовой кислот. Было продемонстрировано, что SCFAs влияют на физиологию человека, такую как ингибирование воспаления, защита от рака и содействие сытости [17–20]. Недавно было показано, что у мышей с дефицитом рецептора 43, связанного с G-белком (GPR43), на животных моделях артрита, аллергического воспаления дыхательных путей и колита усугубляется воспаление [21]. Модель артрита у свободных от микробов мышей также показала усиление воспаления и гораздо более медленное разрешение воспаления по сравнению с обычно выращенными мышами. GPCR43 является рецептором SCFA и, следовательно, обеспечение ацетата в питьевой воде уменьшает воспаление у этих мышей. Следовательно, можно предположить, что SCFAs, включая PA, могут представлять собой неуловимую связь между хозяином и микробиотой.

Ожирение вызывает воспаление в жировой ткани (АТ), что, в свою очередь, связано с такими патофизиологическими явлениями, как СД2. АТ также является основным органом, участвующим в ожирении [20, 22–25]. В текущем исследовании мы определили противовоспалительное действие пропионовой кислоты (PA) на SAT и адипоциты [26].

МЕТОДЫ

Материалы

Гентамицин, глюкоза и пропионовая кислота были приобретены у компании Sigma. Среда М199 была приобретена у Invitrogen. Преадипоциты (клетки, дающие жизнь адипоцитам – ред.) и их среды были приобретены от PromoCell. Кластер дифференцировки 16A (CD16A), Кластер дифференцировки 31 (CD31), матриксные металлопротеиназы 9 (MMP-9), GPCR41 и GPCR43 праймеры были приобретены у Applied Biosystems.

Жировая ткань человека (АТ) и клеточная культура

АТ-экспланты были получены от людей, подвергшихся хирургическому вмешательству по поводу расстройств. Ни у одного человека не было диабета, средний возраст составлял 48 лет, а средний индекс массы тела составлял 28 кг / м2. Это исследование было одобрено Комитетом по надзору за учреждениями (IRB) Национального университета Ан-Наджа (утверждает, контролирует и проводит исследования с участием людей), и письменное согласие было получено от всех субъектов. AT-культивирование проводили, как описано ранее [26, 27], с небольшими модификациями. После последней стадии промывания эксплантаты ткани инкубировали в течение 24 часов с 3 мМ PA или без нее. Экспланты AT предварительно инкубировали с токсином коклюша (PTX) (100 нг / мл) в течение 2 часов. Впоследствии эксплантаты AT обрабатывали PA (3 мМ) в течение 24 часов. Все ткани быстро замораживали в жидком азоте и хранили при -80 °С до выделения РНК. Секрето́м (фракция среды, собранная из культивируемых тканей), предназначенный для ELISA и мульти-ELISA измерений, хранили при -80°C. Что касается преадипоцитов человека, их культивировали и дифференцировали в адипоциты в соответствии с инструкциями PromoCell.

Анализ RT-PCR (ПЦР в реальном времени)

Тотальную РНК выделяли с помощью мини-набора липидной ткани RNeasy и кДНК синтезировали с использованием набора Quantitect (Qiagen). Относительная количественная оценка генов проводилась в трипликатах, как описано ранее [26, 27]. Вкратце, пары праймеров и зонды, используемые в данном исследовании, представлены в Таблице 1. Стабильность нескольких генов домашнего хозяйства оценивалась с помощью программного обеспечения geNorm analysis [28]. GAPDH был выбран в качестве наиболее стабильного гена домашнего хозяйства, экспрессирующегося в АТ.

Таблица 1. Последовательности праймеров

Праймер ID
Последовательность праймеров (5′➔ 3′)
GAPDH прямой
GGT GAAGGTCGGAGT CAA CG
GAPDH обратный
ACC ATG TAGTTGAGGTCAATGAAGG
GAPDH-зонд
CGCCTGGTC ACCAGG GCT GC
GLUT4 прямой
GCT GTGGCTGGTTTC TCC AA
GLUT4 обратный
CCCATAGCCTCC GCAACATA
GLUT4 зонд
CGAGCAACT TCA TCATTGGCATGGGTT
LPL прямой
TGG AGATGT GGACCAGCTAGT G
LPL обратный
CAGAGAGTCGATGAAGAGATGAATG
LPL зонд
CTCCCACGAGCGCT
SREBP1c прямой
GGATTGCACTTTCGAAGACATG
SREBP1c обратный
AGC ATAGGG TGGGTCAAATAGG
SREBP1c зонд
CAGCTTATCAACAAC CAAGACAGTGACTTCCC
CD163 прямой
TGC AGAAAACCCCACAAAAAG
CD163 обратный
CAAGGATCC CGACTGCAATAA
CD163 зонд
AAC AGGTCGCTCATG CCGTCAGTC A
CD16
Hs01569121_m1*
CD31
Hs01065282_m1*
MMP-9
Hs00234579_m1*
GPCR41
Hs00271131_s1*
GPCR43
Hs00271142_s1*

*, Идентификационные номера наборов праймеров от Applied Biosystems

Анализ белков хемокинов и цитокинов в секретируемой фракции

Секретируемые хемокины и цитокины измеряли в культуральных средах методом мультиплексного ИФА в соответствии с инструкциями производителя (Bio-Rad).

Статистика

Сравнение между двумя группами проводилось с помощью двустороннего парного критерия Стьюдента, а остальные анализировались с помощью одно- или двухстороннего анализа ANOVA. Результаты считались статистически значимыми при P <0,05.

РЕЗУЛЬТАТЫ

Влияние пропионовой кислоты (PA) на воспаление подкожно-жировой клетчатки человека (SAT)

Человеческие эксплантаты SAT были получены от 10 женщин. Средние значения их ИМТ, WHR, WC и возраста составляли приблизительно 28, 0,84, 86 и 48 соответственно. Как показано на рис. 1, лечение PA значительно снижало секрецию фактора некроза опухоли-α (TNF-α) и белка, индуцированного интерфероном-гамма (IP-10), приблизительно на 30%. Напротив, экспрессия воспалительных белков макрофагов-1α и -1β (MIP-1α и MIP-1β), регулируемая активацией нормальных Т-клеток, экспрессируемых и секретируемых (RANTES), интерлейкинов (IL-1β, IL-4, IL-10) остались без изменений при стимуляции PA. IL-12 и IL-13 в SAT человека не обнаружены. В адипоцитах секреция TNF-α, IP-10, MIP-1α, MIP-1β, IL-1β, IL-4, IL-10, IL-12 и IL-13 не обнаружена, а моноцитарный хемоаттрактантный белок-1 (MCP-1) не был затронут. Тогда как и неожиданно RANTES был увеличен примерно в 3 раза после лечения PA (рис. 2).

Влияние пропионовой кислоты (РА) на секрецию хемокинов и цитокинов подкожной жировой тканью (SАТ) - ЧАСТЬ1
Влияние пропионовой кислоты (РА) на секрецию хемокинов и цитокинов подкожной жировой тканью (SАТ) - ЧАСТЬ 2

Рис. 1. Влияние пропионовой кислоты (РА) на секрецию хемокинов и цитокинов подкожной жировой тканью (SАТ). Эксплантаты SAT каждого субъекта инкубировали в трех экземплярах с 3 мМ РА или без нее в течение 24 часов. Выделенные количества хемокинов и цитокинов в средах определяли методом мультиплексного ИФА. Результаты выражают в виде относительных величин (RQ) и сравнивают с контролем (без PA; C). (N = 10). **, P <0,01, ***, P <0,001 против контроля (без PA; C). М, среднее значение

Влияние пропионовой кислоты (PA) на секрецию хемокинов и цитокинов адипоцитами человека

Рис. 2. Влияние пропионовой кислоты (PA) на секрецию хемокинов и цитокинов адипоцитами человека. Адипоциты инкубируют в трех повторностях с 3 мМ PA или без нее в течение 24 часов. Выделенные количества хемокинов и цитокинов в средах определяли методом мультиплексного ИФА. Только RANTES и MCP-1 были обнаружены, а остальные не были. Результаты выражены в виде относительных величин (RQ) по сравнению с контролем (без PA; C). *, P <0,05 против контроля (без PA; C). М, среднее значение

Пропионовая кислота (PA) ингибирует экспрессию маркеров макрофагов жировой ткани (АТМ)

PA ингибировала экспрессию мРНК АТМ-маркеров; CD163, MMP-9 и CD16A в SAT примерно на 40%, 52% и 25% соответственно, хотя это не оказывало влияния на экспрессию мРНК CD31, как изображено на рис. 3.

Влияние пропионовой кислоты (РА) на экспрессию мРНК маркеров, связанных с макрофагом жировой ткани (АТМ).

Рис. 3. Влияние пропионовой кислоты (РА) на экспрессию мРНК маркеров, связанных с макрофагом жировой ткани (АТМ). Экспланты подкожной жировой ткани человека (SAT) каждого субъекта инкубировали в трех повторах с 3 мМ РА или без нее в течение 24 часов. PA подавил все маркеры ATM, то есть CD16, CD163 и MMP-9. Уровни экспрессии мРНК определяли с помощью ПЦР в реальном времени (RT-PCR) и выражали в виде относительных величин (RQ) и сравнивали с контролем (без PA; C). (N = 10) *, P <0,05 против контроля (без PA; C). М, среднее значение

Сравнение уровней экспрессии маркеров ATM между сальниковой жировой тканью (OAT), подкожной жировой тканью (SAT) и адипоцитами

Уровни мРНК CD163, CD31 и ММР-9 в ОАТ были значительно в 3201, 9857 и 8553 раза выше, чем в адипоцитах человека, соответственно. Тогда как CD16 не был обнаружен в адипоцитах. По сравнению с SAT уровни мРНК ММР-9 оказались примерно на 50% выше в ОАТ; Но между ОАТ и SАТ существенных различий в отношении уровней мРНК CD163, CD16 и CD31 не было (рис. 4).

Сравнение экспрессии мРНК маркеров макрофагов жировой ткани (АМТ), продуцируемых в сальниковой жировой ткани (ОАТ), SАТ и адипоцитах

Рис. 4. Сравнение экспрессии мРНК маркеров макрофагов жировой ткани (АМТ), продуцируемых в сальниковой жировой ткани (ОАТ), SАТ и адипоцитах. мРНК была выделена из необработанных эксплантов и адипоцитов в трех экземплярах. Уровни экспрессии мРНК определяли с помощью ПЦР в реальном времени (RT-PCR) и выражали в виде относительных величин (RQ) по сравнению с контролем (OAT). (N = 10). *, Р <0,05, ***, Р <0,001 против ОАТ. М, среднее значение

Сравнение уровней экспрессии рецепторов, сопряженных с G-белком (GPCR 41 и 43) между SAT, адипоцитами и макрофагами

Как показано на рис. 5, уровень мРНК рецептора PA GPCR41 был значительно выше в SАТ, чем в адипоцитах и макрофагах, в 125 и 4 раза соответственно. Количество GPCR43 в SAT было похоже на количество, выраженное в макрофагах; тем не менее, оно было значительно ниже в адипоцитах (~ 1050 раз).

Сравнение уровней мРНК GPCR41 и 43, продуцируемых в подкожной жировой ткани человека (SAT), адипоцитах и макрофагах

Рис. 5. Сравнение уровней мРНК GPCR41 и 43, продуцируемых в подкожной жировой ткани человека (SAT), адипоцитах и макрофагах. мРНК была выделена из необработанных эксплантов и адипоцитов в трех экземплярах. Уровни экспрессии мРНК определяли с помощью ПЦР в реальном времени (RT-PCR) и показывали как относительные величины (RQ) по сравнению с контролем (SAT). (N = 10). *, P <0,05 против SAT. М, среднее значение

Пропионовая кислота положительно влияет на ключевые метаболические гены в эксплантах жировой ткани человека

Как мы наблюдали выше, PA оказывала противовоспалительное действие на AT. Чтобы выяснить, оказывает ли противовоспалительное действие PA негативное влияние на ассоциированные маркеры метаболического синдрома, такие как липогенез и чувствительность к инсулину, мы инкубировали эксплантаты SAT с PA или без нее в трех экземплярах. Как показано на рис.6, уровни мРНК липопротеинлипазы (LPL), стерол-регуляторного элемент-связывающего белка-1c (SREBP-1c) и транспортера глюкозы 4 (GLUT-4) во всех эксплантах сильно повышались при лечении PA приблизительно 72%, 41% и 42% соответственно (рис. 6).

Роль пропионовой кислоты (РА) в экспрессии мРНК в маркерах липогенеза и чувствительности к инсулину

Рис. 6. Роль пропионовой кислоты (РА) в экспрессии мРНК в маркерах липогенеза и чувствительности к инсулину. Экспланты подкожной жировой ткани человека (SAT) каждого субъекта инкубировали в трех повторах с 3 мМ РА или без нее в течение 24 часов. PA усиливала экспрессию липопротеинлипазы (LPL), SREBP-1c и GLUT-4. Уровни экспрессии мРНК определяли с помощью ПЦР в реальном времени (RT-PCR) и показывали как относительные количества (RQ) по сравнению с контролем (без PA; C). (N = 10). *, P <0,05, **, P <0,01, ***, P <0,001против контроля (без PA; C). М, среднее значение

Роль Gi/o-белок-связанных рецепторов в противовоспалительном эффекте PA

PA является лигандом как GPCR41, так и GPCR43, которые оба активируют Gi/o-белки для первичной сигнализации PA [26–28]. Чтобы определить роль пути Gi/o в ответе маркеров воспаления на обработку PA в SAT, биопсии SAT предварительно обрабатывали PTX в течение 2 часов, чтобы блокировать путь Gi/o, и затем их обрабатывали 3 мМ PA или без него в течение 24 часов как показано на рис.7, ингибирование высвобождения TNF-α посредством PA было полностью отменено предварительной обработкой PTX, в то время как вызванное PA снижение экспрессии IP-10, CD163 и MMP-9 не было затронуто PTX.

Вовлечение рецептора(ов), связанного с G-белком

Рис. 7. Вовлечение рецептора(ов), связанного с G-белком. Участие Gi/o-связанных рецепторов в опосредовании эффектов пропионовой кислоты (PA) на экспрессию адипокинов было определено путем блокирования сигнального пути Gi/o с коклюшным токсином (PTX). Экспланты подкожной жировой ткани человека (SAT) каждого субъекта инкубировали в трех экземплярах с PTX (100 нг / мл) в течение 2 часов перед инкубацией в течение 24 часов с 3 мМ PA или без нее. Уровни экспрессии белка (TNF-α и IP-10) и мРНК (CD163 и MMP-9) определяли с использованием ELISA и ПЦР в реальном времени (RT-PCR) соответственно. Результаты были представлены в виде относительных величин по сравнению с контролем (без PA). (N = 5). **, P <0,01, ***, P <0,001 против контроля (без PA; C). М, среднее значение

ОБСУЖДЕНИЕ

SCFAs – это в основном метаболиты кишечной микробиоты, ферментирующие уцелевшую непереваренную пищу. Многочисленные исследования показали, что SCFAs ингибируют воспаление с акцентом на бутират и, в меньшей степени, на ацетат и пропионовую кислоту (PA) [16]. В нашем предыдущем исследовании мы показали, что PA обладает противовоспалительными свойствами в сальниковой жировой ткани (ОАТ - Omental adipose tissue) [26, 27]. Противовоспалительные свойства PA были подтверждены, показав, что мыши со сверхэкспрессией рецептора PA (GPR43) остаются худыми, даже когда им дают диету с высоким содержанием жиров (особенно в сальниковой жировой ткани (OAT)). Более того, у этих мышей наблюдается уменьшение макрофагов и признаков воспалительного процесса [29]. Однако влияние PA на SAT человека (насколько нам известно) не исследовалось. Кроме того, известно, что ОАТ и SAT различны [30] в отношении воспаления.

Накопленные данные свидетельствуют о том, что АТ рассматривается как один из основных очагов низкодифференцированного воспаления у лиц с ожирением [23-25], что способствует развитию ассоциированных с ожирением нарушений энергетического обмена, таких как сахарный диабет 2-го типа (СД2) и сердечно-сосудистые заболевания (ССЗ) [4-7]. В настоящем исследовании мы показали, что PA ингибирует секрецию определенных провоспалительных маркеров в организме человека. Это согласуется с влиянием PA на OAT [26], но в меньшей степени. Примечательно, что это согласуется с нашим более ранним выводом о том, что PA ингибирует высвобождение белка резистина (провоспалительный параметр) и экспрессию мРНК как в OAT, так и в SAT [27]. Хотя хорошо известно, что ожирение связано с повышенной инфильтрацией макрофагов в АТ человека [32], которые идентифицируются с помощью специфических АТМ-маркеров, АТ также содержит в себе макрофаги. В настоящем исследовании было показано, что PA оказывает большое влияние на маркеры АТМ, подтверждающие тот факт, что PA обладает противовоспалительными свойствами.

Большинство исследованных провоспалительных маркеров не были обнаружены в секретоме адипоцитов, а выявленные не были снижены в ответ на лечение PA. Это может быть связано с очень низким уровнем экспрессии PA-рецепторов GPCR-41 и -43 в адипоцитах по сравнению с макрофагами и SAT. Принимая все это вместе, можно предположить, что неадипоцитарные клетки, скорее всего макрофаги, реагируют на противовоспалительное действие PA.

Противовоспалительные свойства PA связаны с другими основными метаболическими путями в АТ, а именно липогенезом и метаболизмом глюкозы. Мы обнаружили, что экспрессия как LPL, так и GLUT-4 была повышена с помощью PA. Известно, что экспрессия LPL и GLUT4 регулируется SREBP-1c [33, 34]. Действительно, мы обнаружили повышенную экспрессию SREBP1c при стимуляции PA, предполагая, что SREBP-1c отвечает за повышенную экспрессию LPL и GLUT4. Эти данные также предполагают, что PA обладает не только противовоспалительным действием, но и может оказывать анаболический эффект, подобный инсулину, индуцируя два важных метаболических пути, которые также стимулируются инсулином. Это согласуется с реакцией овса на PA в наших предыдущих исследованиях [16, 26, 35] и с другими исследованиями, в которых было обнаружено, что SCFAs повышает чувствительность к инсулину [35].

Экспрессия двух PA-рецепторов (GPRC41 и GPRC43) в AT человека (36) подтверждает, что эффекты PA на AT могут опосредоваться этими рецепторами. Было показано, что существует уникальная связь Gi/o для GPCR41, но для GPCR43 существует двойная связь посредством белков Gi/o и Gq [36]. В этом исследовании мы обнаружили, что ответ TNF-α на PA происходит через белок Gi/o, предполагая, что противовоспалительные эффекты PA опосредованы рецепторами, связанными с G-белком, в то время как ответ IP-10CD163 и MMP-9 не был опосредован через путь Gi/o. Эти результаты согласуются с нашим более ранним исследованием [26], предполагающим, что и SAT, и OAT используют сходный путь (т. е. путь рецепторов, связанных с белком Gi/o). Однако наши результаты не исключают роли других путей, таких как белки Gq и PPARy. Поэтому необходимы дальнейшие исследования для вскрытия лежащего в основе молекулярного пути (путей).

Примечательно, что пропионовая кислота оказывает противовоспалительное действие на подкожную жировую ткань человека, что сопровождается улучшенной экспрессией параметров, связанных с липогенезом и поглощением глюкозы.

Мы также демонстрируем, что противовоспалительные эффекты частично опосредованы Gi/o белками и, скорее всего, через макрофаги. Эта находка аналогична нашим результатам, которые мы наблюдали в сальниковой жировой ткани (OAT) в нашем предыдущем исследовании [26, 37, 38]. Настоящее исследование предлагает новую парадигму для понимания взаимосвязи между микробиотой и физиологией жировой ткани (AT) и ее потенциальной силой в предотвращении ожирения, связанного с воспалением и нарушениями энергетического обмена. Противовоспалительные свойства пропионовой кислоты на макрофагах, роль рецепторов GPCR41 и GPCR43 и другие потенциальные механизмы, лежащие в основе, такие как PPARγ, еще предстоит выяснить. Эти исследования помогают нам лучше понять воспалительные пути в жировых тканях и макрофагах для исследований и разработок лекарственных препаратов.

См. дополнительно:

Литература

  1. W.H.O. Obesity and overweight fact sheets 2014; Available from: http://www.who.int/mediacentre/factsheets/fs311/en/
  2. Abdul-Rahim HF, Holmboe-Ottesen G, Stene LCM, Husseini A, Giacaman R, Jervell J, et al. Obesity in a rural and an urban Palestinian West Bank population. Int J Obes Relat Metab Disord. 2003;27(1):140–6.
  3. Festa A, D'Agostino Jr R,Williams K, Karter AJ, Mayer-Davis EJ, Tracy RP, et al. The relation of body fat mass and distribution to markers of chronic inflammation. Int J Obes Relat Metab Disord. 2001;25(10):1407–15.
  4. Wellen KE, Hotamisligil GS. Inflammation, stress, and diabetes. J Clin Invest. 2005;115(5):1111–9.
  5. Rahimi M,Vinciguerra M, Daghighi M,Özcan B, Akbarkhanzadeh V, Sheedfar F, et al. Age-related obesity and type 2 diabetes dysregulate neuronal associated genes and proteins in humans. Oncotarget. 2015;6(30):18–32.
  6. Hansson GK. Inflammation, atherosclerosis, and coronary artery disease. N Engl J Med. 2005;352(16):1685–95.
  7. Van Gaal LF, Mertens IL, De Block CE. Mechanisms linking obesity with cardiovascular disease. Nature. 2006;444(7121):875–80.
  8. Ley RE, Backhed F, Turnbaugh P, Lozupone CA, Knight RD, Gordon JI. Obesity alters gut microbial ecology. Proc Natl Acad Sci U S A. 2005;102(31):11070–5.
  9. Jazayeri O, Daghighi SM, Rezaee F. Lifestyle alters GUT-bacteria function: linking immune response and host. Best Pract Res Clin Gastroenterol. 2017;31(6):625–35.
  10. Backhed F, Ding H, Wang T, Hooper LV, Koh GY, Nagy A, et al. The gut microbiota as an environmental factor that regulates fat storage. Proc Natl Acad Sci U S A. 2004;101(44):15718–23.
  11. Cani PD, Amar J, Iglesias MA, Poggi M, Knauf C, Bastelica D, et al.Metabolic endotoxemia initiates obesity and insulin resistance. Diabetes. 2007;56(7):1761–72.
  12. Turnbaugh PJ, Ley RE, Mahowald MA, Magrini V, Mardis ER, Gordon JI. An obesity-associated gut microbiome with increased capacity for energy harvest. Nature. 2006;444(7122):1027–31.
  13. Ritsema T, Smeekens S. Fructans: beneficial for plants and humans. Curr Opin Plant Biol. 2003;6(3):223–30.
  14. Cani PD, Joly E, Horsmans Y, Delzenne NM. Oligofructose promotes satiety in healthy human: a pilot study. Eur J Clin Nutr. 2006;60(5):567–72.
  15. Cani PD, Knauf C, Iglesias MA, Drucker DJ, Delzenne NM, Burcelin R. Improvement of glucose tolerance and hepatic insulin sensitivity by oligofructose requires a functional glucagon-like peptide 1 receptor. Diabetes. 2006;55(5):1484–90.
  16. Keenan MJ, Zhou J, McCutcheon KL, Raggio AM, Bateman HG, Todd E, et al. Effects of resistant starch, a non-digestible fermentable fiber, on reducing body fat. Obesity (Silver Spring). 2006;14(9):1523–34.
  17. Wong JM, et al. Colonic health: fermentation and short chain fatty acids. J Clin Gastroenterol. 2006;40(3):235–43.
  18. Cook SI, Sellin JH. Review article: short chain fatty acids in health and disease. Aliment Pharmacol Ther. 1998;12(6):499–507.
  19. Hamer HM, Jonkers D, Venema K, Vanhoutvin S, Troost FJ, Brummer RJ. Review article: the role of butyrate on colonic function. Aliment Pharmacol Ther. 2008;27(2):104–19.
  20. Rezaee F, Dashty M. Role of adipose tissue in metabolic system disorders: adipose tissue is the initiator of metabolic diseases. Journal of diabetes and metabolism. J. Diabetes Metab. 2013;S13.
  21. Al-Lahham SH, et al. Biological effects of propionic acid in humans; metabolism, potential applications and underlying mechanisms. Biochim Biophys Acta. 2010;1801(11):1175–83.
  22. Maslowski KM, Vieira AT, Ng A, Kranich J, Sierro F, di Yu, et al. Regulation of inflammatory responses by gut microbiota and chemoattractant receptor GPR43. Nature. 2009;461(7268):1282–6.
  23. Trayhurn P,Wood IS. Adipokines: inflammation and the pleiotropic role of white adipose tissue. Br J Nutr. 2004;92(3):347–55.
  24. Skopkova M, et al. Protein array reveals differentially expressed proteins in subcutaneous adipose tissue in obesity. Obesity (Silver Spring). 2007;15(10):2396–406.
  25. Juge-Aubry CE, Henrichot E, Meier CA. Adipose tissue: a regulator of inflammation. Best Pract Res Clin Endocrinol Metab. 2005;19(4):547–66.
  26. Al-Lahham S, et al. Propionic acid affects immune status and metabolism in adipose tissue from overweight subjects. Eur J Clin Investig. 2012;42(4):357–64.
  27. Al-Lahham SH, et al. Regulation of adipokine production in human adipose tissue by propionic acid. Eur J Clin Investig. 2010;40(5): 401–7.
  28. Vandesompele J, et al. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. 2002;3(7) p. RESEARCH0034.
  29. Kimura I, Ozawa K, Inoue D, Imamura T, Kimura K, Maeda T, et al. The gut microbiota suppresses insulin-mediated fat accumulation via the short-chain fatty acid receptor GPR43. Nat Commun. 2013;4:1829.
  30. Lee MJ,Wu Y, Fried SK. Adipose tissue heterogeneity: implication of depot differences in adipose tissue for obesity complications. Mol Asp Med. 2013;34(1):1–11.
  31. Bruun JM, Lihn AS, Pedersen SB, Richelsen B. Monocyte chemoattractant protein-1 release is higher in visceral than subcutaneous human adipose tissue (AT): implication of macrophages resident in the AT. J Clin Endocrinol Metab. 2005;90(4):2282–9.
  32. Curat CA, Miranville A, Sengenes C, Diehl M, Tonus C, Busse R, et al. From blood monocytes to adipose tissue-resident macrophages: induction of diapedesis by human mature adipocytes. Diabetes. 2004;53(5):1285–92.
  33. Im SS, Kwon SK, Kang SY, Kim TH, Kim HI, Hur MW, et al. Regulation of GLUT4 gene expression by SREBP-1c in adipocytes. Biochem J. 2006;399(1):131–9.
  34. Kim JB, SpiegelmanBM. ADD1/SREBP1 promotes adipocyte differentiation and gene expression linked to fatty acid metabolism. Genes Dev. 1996;10(9):1096–107.
  35. Canfora EE, Jocken JW, Blaak EE. Short-chain fatty acids in control of body weight and insulin sensitivity. Nat Rev Endocrinol. 2015;11(10):577–91.
  36. Le Poul E, et al. Functional characterization of human receptors for short chain fatty acids and their role in polymorphonuclear cell activation. J Biol Chem. 2003;278(28):29481–9.
  37. Brown AJ, Goldsworthy SM, Barnes AA, Eilert MM, Tcheang L, Daniels D, et al. The orphan G protein-coupled receptors GPR41 and GPR43 are activated by propionate and other short chain carboxylic acids. J Biol Chem. 2003;278(13):11312–9.
  38. Nilsson NE, Kotarsky K, Owman C, Olde B. Identification of a free fatty acid receptor, FFA2R, expressed on leukocytes and activated by short-chain fatty acids. Biochem Biophys Res Commun. 2003;303(4):1047–52.

Будьте здоровы!

ССЫЛКИ К РАЗДЕЛУ О ПРЕПАРАТАХ ПРОБИОТИКАХ

  1. ПРОБИОТИКИ
  2. ДОМАШНИЕ ЗАКВАСКИ
  3. БИФИКАРДИО
  4. КОНЦЕНТРАТ БИФИДОБАКТЕРИЙ ЖИДКИЙ
  5. ПРОПИОНИКС
  6. ЙОДПРОПИОНИКС
  7. СЕЛЕНПРОПИОНИКС
  8. МИКРОЭЛЕМЕНТНЫЙ СОСТАВ
  9. ПРОБИОТИКИ С ПНЖК
  10. БИФИДОБАКТЕРИИ
  11. ПРОПИОНОВОКИСЛЫЕ БАКТЕРИИ
  12. ПРОБИОТИКИ И ПРЕБИОТИКИ
  13. СИНБИОТИКИ
  14. РОЛЬ МИКРОБИОМА В ТЕРАПИИ РАКА
  15. АНТИОКСИДАНТНЫЕ СВОЙСТВА
  16. АНТИОКСИДАНТНЫЕ ФЕРМЕНТЫ
  17. АНТИМУТАГЕННАЯ АКТИВНОСТЬ
  18. МИКРОФЛОРА КИШЕЧНОГО ТРАКТА
  19. МИКРОБИОМ ЧЕЛОВЕКА
  20. МИКРОФЛОРА И ФУНКЦИИ МОЗГА
  21. ПРОБИОТИКИ И ХОЛЕСТЕРИН
  22. ПРОБИОТИКИ ПРОТИВ ОЖИРЕНИЯ
  23. МИКРОФЛОРА И САХАРНЫЙ ДИАБЕТ
  24. ПРОБИОТИКИ и ИММУНИТЕТ
  25. МИКРОБИОМ И АУТОИММУННЫЕ БОЛЕЗНИ
  26. ПРОБИОТИКИ и ГРУДНЫЕ ДЕТИ
  27. ПРОБИОТИКИ, БЕРЕМЕННОСТЬ, РОДЫ
  28. ДИСБАКТЕРИОЗ
  29. ВИТАМИННЫЙ СИНТЕЗ
  30. АМИНОКИСЛОТНЫЙ СИНТЕЗ
  31. АНТИМИКРОБНЫЕ СВОЙСТВА
  32. СИНТЕЗ ЛЕТУЧИХ ЖИРНЫХ КИСЛОТ
  33. СИНТЕЗ БАКТЕРИОЦИНОВ
  34. ФУНКЦИОНАЛЬНОЕ ПИТАНИЕ
  35. АЛИМЕНТАРНЫЕ ЗАБОЛЕВАНИЯ
  36. ПРОБИОТИКИ ДЛЯ СПОРТСМЕНОВ
  37. ПРОИЗВОДСТВО ПРОБИОТИКОВ
  38. ЗАКВАСКИ ДЛЯ ПИЩЕВОЙ ПРОМЫШЛЕННОСТИ
  39. НОВОСТИ