Пропионат как микробный метаболит для здоровья

Пропионат как способствующий здоровью микробный метаболит в кишечнике человека 

Пропионат как способствующий здоровью микробный метаболит в кишечнике человека

Tom Van de Wiele et al.
Propionate as a health-promoting microbial metabolite in the human gut
Nutrition Reviews, Volume 69, Issue 5, 1 May 2011, Pages 245–258

СОДЕРЖАНИЕ:

Примечание редактора

Информация, представленная в данном разделе, может быть полезна для разработки функциональных пищевых стратегий, направленных на продвижение связанных с пропионатом преимуществ для здоровья, некоторые из которых установлены в исследованиях:

  • Пропионибактерии индуцируют апоптоз клеток колоректальной карциномы через короткоцепочечные жирные кислоты (SCFAs), в частности, пропионат, действующего на митохондрии;
  • Пропионат защищает костную систему от патологического разрушения (предотвращает остеопороз);
  • Адресная доставка пропионата в толстую кишку нормализует вес у взрослых;
  • Пропионат является причиной повышения физической выносливости;
  • Пропионат обладает противовоспалительным действием на воспаление подкожно-жировой клетчатки человека;
  • Пропионат может служить мощной иммуномодулирующей добавкой к препаратам от рассеянного склероза;
  • Пропионат имеет благоприятный потенциал для дофаминергических нейронов при болезни Паркинсона;
  • Пропионат защищает гематоэнцефалический барьер от окислительного стресса.

Отдельно стоит отметить, что наиболее известными продуцентами пропионата являются пробиотические пропионовокислые бактерии, входящие в состав биоконцентратов "Селенпропионикс", "Йодпропионикс" и "Пропионикс", и с помощью которых (в т.ч. ферментированных с их использованием кисломолочных продуктов) можно повысить пропионатный уровень в ободочной кишке. Для усиления синтеза можно также использовать отдельные пребиотические пищевые субстраты, речь о которых пойдет ниже.


Резюме. Пропионат (пропионовая кислота) является основным метаболитом микробной ферментации в кишечнике человека с предполагаемым воздействием на здоровье, которое выходит за пределы кишечного эпителия. Считается, что пропионат снижает липогенез, уровень холестерина в сыворотке крови и канцерогенез в других тканях. Таким образом, управление производством микробного пропионата через диету может быть мощной стратегией для увеличения воздействия на здоровье микробной ферментации углеводов. В настоящем обзоре сначала обсуждаются два основных пути производства пропионата и приводится расширенный генный список микроорганизмов, обладающих потенциалом для производства пропионата. Во-вторых, он оценивает перспективный потенциал арабиноксилана, полидекстрозы и L-рамнозы действовать в качестве субстратов для увеличения микробного пропионата. В-третьих, учитывая сложность микробиоты кишечника, производство пропионата рассматривается с микробно-экологической точки зрения, которая включает в себя процессы взаимодействия, такие как механизмы перекрестного питания. Наконец, он (обзор) вводит разработку функциональных аналитических инструментов на основе генов для обнаружения и характеристики продуцирующих пропионат микроорганизмов в сложном сообществе. Информация в этом обзоре может быть полезна для разработки функциональных пищевых стратегий, направленных на продвижение связанных с пропионатом преимуществ для здоровья.

ВСТУПЛЕНИЕ

Микробное сообщество в желудочно-кишечном тракте человека играет существенную роль в здоровье и болезнях.1 эта кишечная микробиота устанавливает благоприятные отношения с человеком-хозяином, модулируя иммунологические функции2 и влияя на рост и функционирование клеток-хозяев.1 с другой стороны, микробиота кишечника может негативно влиять на хозяина через повышенное ожирение,3 воспалительные заболевания кишечника,1 и колоректальный рак.4

Короткоцепочечные жирные кислоты (SCFAs) являются основными продуктами бактериальной ферментации пищевых углеводов в толстой кишке. Основными соединениями являются уксусная, пропионовая и n-масляная кислоты, встречающиеся примерно в молярном соотношении 60:20:20 в толстой кишке.5 Эти анионы играют решающую роль как в морфологии кишечника, так и в его функционировании. Бутират6 получил много внимания как источник энергии для колоноцитов.7 Кроме того, он был описан как антиканцерогенный агент, предотвращающий рост8,9 и стимулирующий дифференцировку10 эпителиальных клеток толстой кишки. Ацетат используется в качестве субстрата для синтеза холестерина и жирных кислот в печени,11,12 увеличивает кровоток в толстой кишке и поглощение кислорода, и усиливает моторику подвздошной кишки, влияя на сокращения подвздошной кишки.6

Настоящий обзор фокусируется на потенциальных последствиях для здоровья только одной SCFA – пропионовой кислоты (пропионата). Хотя пропионат менее часто изучается по сравнению с другими микробными метаболитами, такими как бутират, он обладает некоторыми отличными оздоровительными свойствами. Таким образом, Цель настоящего обзора состоит в том, чтобы сосредоточиться на потенциальном воздействии пропионата на здоровье и дать больше информации о механизме производства пропионата в кишечнике и о том, как можно модулировать производство пропионата с помощью пищевых субстратов. Обсуждаются возможные микробные взаимодействия между продуцентами пропионата и другими кишечными микроорганизмами, а также некоторые современные и новые стратегии обнаружения и идентификации продуцентов пропионата.

ПОТЕНЦИАЛЬНЫЕ ВОЗДЕЙСТВИЯ НА ЗДОРОВЬЕ

Избыток пропионата и невозможность его превращения в метилмалонил-КоА через пропионил-КоА вызывает пропионовую ацидемию. Пропионовая ацидемия, как наиболее частое нарушение метаболизма органических кислот у людей, является врожденной ошибкой метаболизма, вызванной генетическим дефицитом пропионил-КоА-карбоксилазы13. Несмотря на этот аспект токсичности, было показано, что пропионовая кислота обладает антилипогенным и снижающим уровень холестерина эффектами.14 Она также оказывает сильное влияние на контроль веса и пищевое поведение.15–17 Кроме того, имеются доказательства того, что пропионат оказывает, как и бутират, антипролиферативный эффект в отношении раковых клеток толстой кишки.10,18 Следует подчеркнуть, что знание концентрация пропионата в толстой кишке in vivo или концентрации SCFA в целом недостаточно для определения воздействия на здоровье. Сравнение портальной крови с содержанием толстой кишки показывает, что сорбция SCFA колоноцитами является высокоэффективной, при этом концентрации в портальной крови составляют незначительную долю от концентрации в толстой кишке. Тем не менее, в отличие от бутирата, который используется колоноцитами в качестве источника энергии, пропионат обнаруживается в более высоких концентрациях в кровообращении19. Что касается пропионата, действие которого в колоноцитах менее известно, физиологические концентрации по-прежнему оказывают воздействие на здоровье как в клеточных культурах человека, так и животных.11,20 Таким образом, биологическая активность пропионата может не ограничиваться самой ободочной кишкой, но распространяются на другие части человеческого тела. Конкретные воздействия пропионата на здоровье приведены в таблице 1.

Таблица 1. Воздействие на здоровье, связанное с пропионатом.

Исследование
Эффект
Ref.
Липогенез в гепатоцитах
Исследование in vivo на крысах, получавших инулин
Снижение уровня холестерина в сыворотке
Illman et al. (1988)23 
Исследование in vitro с изолированными гепатоцитами крысы
Ингибирование синтеза жирных кислот
Nishina and Freedland (1990)12 
Исследование in vivo на крысах, получавших инулин
Снижение липогенеза печени
Delzenne and Williams (2002)14 
Исследование на крысах in vivo
Снижение уровня холестерина в печени и плазме
Adam et al. (2001)24 
Сытость
Исследование in vivo на грызунах
Активация GLP-1 и PYY
Zhou et al. (2008)17 
Исследование на крысах in vivo
Повышенные уровни GLP-1 и PYY в пуле слепой кишки, проксимальном отделе толстой кишки и портальной сыворотке, сниженные уровни грелина
Delzenne et al. (2005)29 
Исследование in vivo с кормящими молочными коровами
Снижение потребления энергии и размера пищи, увеличение интервала между приемами пищи
Oba and Allen (2001)15 
In vivo человеческое исследование
Большее чувство сытости, менее голодный и уменьшенное желание есть
Ruijschop et al. (2008)16 
Исследование in vivo на мышах
Удвоенный уровень лептина в плазме
Xiong et al. (2004)20 
Исследование на мышах in vitro
Стимулированная экспрессия лептина как в клеточной линии адипоцитов мыши, так и в ткани адипоцитов мыши в первичных культурах
Xiong et al. (2004)20 
Исследование in vitro с висцеральной жировой тканью человека
Индуцированная продукция лептина как на уровне мРНК, так и на уровне белка
Lahham et al. (2008)33 
Рак
Исследование in vitro с клеточными линиями рака толстой кишки
Антипролиферативный эффект
Scheppach et al. (1995)34 
Исследование in vitro с клетками колоректальной карциномы
Индукция апоптоза
Jan et al. (2002)18 

Пропионат влияет на синтез липидов гепатоцитами

Синтез липидов печенью включает превращение полученных из пищи жирных кислот и глицерина в холестерин и триглицериды с различным составом жирных кислот. Эти печеночные липидные молекулы затем включаются в липопротеины, чтобы обеспечить распределение в различные ткани через кровообращение. Интересно, что синтез липидов в гепатоцитах сильно зависит от количества и типов SCFAs, вырабатываемых в результате ферментации клетчатки в кишечнике.12,13 Было определено, что пропионат, в частности, играет существенную роль в некоторых из этих процессов; однако до сих пор ведутся споры о точном механизме его антилипогенного и холестеринового действия.

Ранние наблюдения диетической модуляции синтеза липидов в печени выявили сильную корреляцию с потреблением пищевых волокон. Существует обширная информация in vivo о корреляции между потреблением растительных волокон, синтезом холестерина и триглицеридов у экспериментальных животных, а также у человека. Эти исследования показали, что пероральное введение растворимых волокон, таких как пектин или гуаровая камедь, значительно снижает концентрацию холестерина в сыворотке крови. Этот эффект частично объяснялся следующим: 1) повышением экскреции холестерина и желчных кислот из кишечника с калом; 2) более высокой печеночной скоростью преобразования холестерина в желчные кислоты; и 3) оптимизированным периферическим метаболизм липопротеинов путем уменьшения размера хиломикронов и снижения инкорпорации холестерина в хиломикроны.21

Дальнейший анализ экспериментов с пищевыми волокнами указал на специфическую роль SCFAs, как конечных продуктов микробной ферментации углеводов, в синтезе липидов печени.12,13 Тем не менее, влияние SCFAs на синтез жира и уровень холестерина следует рассматривать с точки зрения типа производимых SCFAs. Более конкретно, было показано, что пропионат как продукт кишечной ферментации волокон снижает уровень холестерина в сыворотке крови при скармливании крысам.23 Исследования In vitro с изолированными гепатоцитами крыс показали ингибирующее действие пропионата на синтез жирных кислот, но не на синтез холестерина, хотя пропионат уменьшал включение [1-14С] ацетата в стерины на 90%.13 Кроме того, пропионат был идентифицирован как молекула, которая уменьшает липогенез печени у крыс, получавших инулин.14 Другие эксперименты на крысах показали, что включение цельнозерновой диеты снижает уровень холестерина как в печени, так и в плазме, а также уровень холестерина в триглицеридах плазмы, в то время как на печеночные триглицериды это не влияет. Помимо нескольких механизмов, предложенных в этом исследовании, авторы также упомянули о влиянии повышенной концентрации пропионата в воротной вене, связанной с диетой из цельных волокон, на синтез холестерина и жирных кислот.24

Механизм индуцированного пропионатом ингибирования синтеза липидов был исследован Lin et al. 11 с использованием гепатоцитов крысы и [14C] ацетата. Исследователи наблюдали 50% ингибирование синтеза холестерина и триглицеридов в присутствии концентрации пропионата 0,1 ммоль / л. Используя в 10–100 раз более высокие уровни меченого ацетата, они отвергли возможность того, что пропионат конкурирует с меченым ацетатом и снижает синтез холестерина и жирных кислот из-за разбавления пула предшественников. Поэтому было высказано предположение, что пропионат может влиять на активность общего ключевого фермента, такого как ацетил-КоА-синтетаза.12 Действительно, когда ацетат попадает в гепатоциты, он в основном превращается в ацетил-КоА с помощью ацетил-КоА-синтетазы и затем попадает в холестерин и цикл синтеза жирных кислот. Пропионат также оказывает конкурентное действие по отношению к белку, который выделяется при поступлении ацетата в клетки печени. Таким образом, это ингибирование будет способствовать снижению синтеза холестерина и жирных кислот.

Несмотря на убедительные результаты этих исследований, другие исследования не всегда могли подтвердить ингибирующее действие пропионата на метаболизм липидов. Например, ежедневное добавление в пищу 9,9 г пропионата натрия в хлебе не изменило липидный обмен у шести здоровых добровольцев и даже привело к повышению концентрации триглицеридов у пяти субъектов25. В другом исследовании сравнивали влияние пропионата на метаболизм липидов. между гепатоцитами человека и крысы.12 Было обнаружено ингибирующее действие пропионата в концентрации 0,1 ммоль / л на синтез липидов из ацетата у крыс. Однако в гепатоцитах человека для достижения такого же ингибирующего эффекта требовалась более высокая концентрация пропионата, около 10–20 ммоль / л. Это значение в 100–200 раз превышает концентрацию пропионата в портальной крови, что указывает на то, что модели крыс не могут быть полностью экстраполированы на человеческую ситуацию12. В некоторых других исследованиях введение пропионата в слепую кишку свиней или перфузия пропионата в толстую кишку человека, не влияет на уровень холестерина в сыворотке крови.26,27

Пропионат как молекула, влияющая на сытость

В дополнение к оказанию понижающего холестерин и антилипогенного действия, пропионат может быть вовлечен в контроль веса, стимулируя сытость. Роль SCFAs (уксусная кислота, пропионовая кислота, масляная кислота) как триггеров, вызывающих чувство сытости, была заявлена ​​в предыдущих исследованиях.17,28 Существуют доказательства того, что бактериальная регуляция кишечных пептидов, таких как глюкагоноподобный пептид 1 (GLP-1) и пептид YY (PYY) опосредуется SCFAs, продуцируемыми из неперевариваемых субстратов, таких как инулин и олигофруктоза29. Кроме того, физиологические концентрации ацетата, пропионата и бутирата, а также снижение рН с 7,5 до 6,0 значительно повышают проглюкагон и PYY. в энтероэндокринной клеточной линии толстой кишки STC-1.17 GLP-1 и PYY представляют собой гормоны, стимулирующие чувство насыщения, которые высвобождаются в ответ на потребление питательных веществ L-клетками, главным образом в подвздошной кишке и толстой кишке. GLP-1 способствует секреции инсулина и пролиферации β-клеток поджелудочной железы в дополнение к контролю синтеза гликогена в мышечных клетках, 30 в то время как PYY замедляет опорожнение желудка. Напротив, грелин стимулирует аппетит и в основном вырабатывается P/D1 клетками в желудке.31 Неперевариваемые углеводы, такие как олигофруктоза,32 лактитол,28 и устойчивый крахмал17, эффективны для вызывания сытости путем модуляции выработки кишечных пептидов GLP-1, PYY и грелина через механизм, который также включает модуляцию микробного сообщества кишечника.

Среди SCFAs пропионат, в частности, был исследован как индуцирующий насыщение агент с сильным влиянием на потребление энергии и поведение при кормлении. Испытания на людях и животных показали, что введение пропионата (в диапазоне 130-930 ммоль/л in vivo и 0,01–10 ммоль / л in vitro) приводит к значительно большему чувству сытости и более низкому желанию есть.15–17,24

Одним из сигналов насыщения, вызываемых пропионатом, в частности, является лептин, мощный анорексигенный гормон, который подавляет прием пищи через рецепторы, экспрессируемые в центральной нервной системе. Xiong et al.20 показано, что введение пропионата натрия в дозе 500 ммоль/сут почти вдвое увеличивает концентрацию лептина в плазме крови мышей. Кроме того, SCFAs, и пропионат в частности, стимулировали экспрессию лептина как в клеточной линии мышиных адипоцитов, так и в жировой ткани мыши в первичной культуре.20 В другом исследовании пропионат в концентрации 3 ммоль / л индуцировал выработку лептина в висцеральной жировой ткани человека как на уровне мРНК, так и на уровне белка.33 Эти данные свидетельствуют о том, что модулирующий эффект кишечной микробиоты в отношении ожирения может быть частично опосредован SCFAs, в частности пропионовой кислотой, которая образуется в результате микробной ферментации углеводов.

Потенциальная роль пропионата в развитии рака

Влияние SCFAs на рак, а точнее на рак толстой кишки, было тщательно исследовано.10,18,34 Бутират способен модулировать экспрессию генов и влияет на ключевые регуляторы апоптоза и клеточного цикла. Несколько механизмов способствуют регулирующему влиянию бутирата на экспрессию генов. Они включают в себя гиперацетилирование гистонов и негистоновых белков, а также изменение метилирования ДНК, что приводит к повышению доступности транскрипционных факторов к нуклеосомной ДНК.35 В другом исследовании Jan et al.,18 пропионат и ацетат (на уровне 26-40 и 9–16 ммоль / л соответственно) вызывали типичные признаки апоптоза в клеточных линиях колоректальной карциномы человека. Этот эффект включал в себя потерю митохондриального трансмембранного потенциала, образование активных форм кислорода, обработку каспазой-3 и конденсацию ядерного хроматина.

SCFAs оказывают парадоксальное влияние на пролиферацию эпителиальных клеток толстой кишки. В то время как эти анионы стимулируют пролиферацию нормальных криптовых клеток, n-бутират и пропионат, они ингибируют рост в клеточных линиях рака толстой кишки.34 Бутират и пропионат также являются наиболее сильными жирными кислотами, индуцирующими дифференцировку и апоптоз.37 Таким образом, они защищают от развития рака в целом10,36 и от колоректального рака в частности.18,37 Хотя считается, что бутират более эффективен, чем пропионат,38 он в основном поглощается колоноцитами в качестве источника энергии.8 Напротив, пропионат и ацетат достигают циркуляции в гораздо более высокой концентрации, чем бутират, и они значительно поглощаются печенью (около 60%).19 Из-за высокой концентрации этих анионов в печени, весьма вероятно, что они влияют на раковые клетки печени, а также на другие типичные раковые клетки, которые, как известно, вызывают метастазирование в печени, такие как рак молочной железы и толстой кишки.39 Дальнейшее поглощение SCFAs происходит в периферических тканях, в результате 47% снижения SCFAs в периферической венозной крови. Тем не менее, исследование жертв внезапной смерти показало, что количество SCFAs в периферической крови все еще поддается количественной оценке.19 Таким образом, антиканцерогенное действие этого циркулирующего пропионата, наряду с ацетатом и бутиратом, представляло бы интерес для изучения; например, в какой степени этот эффект может распространяться за пределы тонкой или толстой кишки и печени и, таким образом, влиять на различные ткани?

СУБСТРАТЫ, ВЛИЯЮЩИЕ НА ПРОИЗВОДСТВО ПРОПИОНАТА

Неперевариваемые углеводы, устойчивые к ферментативному перевариванию в тонком кишечнике, далее расщепляются кишечными бактериями. Пребиотики определяются как неперевариваемые углеводы, которые благотворно влияют на здоровье хозяина, избирательно стимулируя рост и/или активность одной или ограниченного числа бактерий в толстой кишке.40 Хотя влияние субстратов на продукцию SCFAs в дистальном отделе кишечника отрицалось в некоторых исследованиях,41,42 многие исследования продемонстрировали их SCFA-повышающие свойства. Некоторые фактические и потенциальные пробиотические соединения, влияющие на выработку пропионата, подробно описаны в следующем разделе. Из-за различий в экспериментальной установке, структуре и концентрации соединений, а также в исследованиях кишечного микробного сообщества вариабельность модулирующих эффектов пропионата этих соединений высока, и проведение сравнений между различными субстратами затруднено. Важно отметить, что прямая связь между производством пропионата и концентрацией люминального пропионата может быть установлена только в контексте in vitro при отсутствии кишечной абсорбции. Краткое описание основных субстратов, индуцирующих выработку пропионата, приведено в таблице 2.

Таблица 2. Субстраты, влияющие на выработку пропионата.

Субстрат
Исследование
Эффект*
Продолжи-тельность обработки
Ref.

L-рамноза

Исследование In vitro с человеческими фекалиями

Избирательное увеличение производства пропионата

24ч

Fernandes et al. (2000)43 

In vivo человеческое исследование

Избирательное увеличение сывороточного пропионата по сравнению с контролем

28 дней

Vogt et al. (2004)44 

D-тагатоза

In vivo исследование свиней

Пропорциональное увеличение пропионата в разных сегментах толстой кишки

18 дней 

Laerke and Jensen  (1999)47 

Резистентный крахмал 

Исследование на крысах in vivo 

Избирательное повышение уровней пропионата в сыворотке, связанное со снижением уровня триглицеридов и холестерина в печени

4 недель

Cheng and Lai (2000)49 

Инулин

 

Исследование in vitro со симулятором кишечника человека

Увеличение производства SCFA, особенно пропионата и бутирата

5 недель

Van De Wiele et al. (2004)50 

Исследование на крысах in vivo

Пропорциональное увеличение просветной концентрации пропионата, снижение уровня триглицеридов в плазме

21 день

Brouns et48 al. (2002) Levrat at al. (1991)52 

 

Полидекстроза

Исследование in vitro с 4-этапным симулятором толстой кишки 

Увеличение производства SCFA, особенно пропионата

48ч

Makelainen et al. (2007)53 

Арабиноксиланы (AX) 

Исследование на крысах in vivo

Пониженный рН слепой кишки, накопление SCFA (особенно пропионата), снижение абсорбции холестерина

Переменная между субъектами

Lopez et al. (1999)54 

Арабино-ксилановые олигосахариды (AXOS) 

Исследование in vitro со симулятором кишечника человека

Более высокая выработка SCFA, особенно пропионата в поперечном отделе ободочной кишки, сопровождается снижением выработки лактата в том же отделе, что указывает на вероятное производство пропионата через акрилатный путь

3 недели

Grootaert et al. (2009)56 

Исфагула

Исследование на крысах in vivo

Более высокая продукция SCFA, особенно пропионата в слепой кишке, проксимальном и дистальном отделах толстой кишки и кале

28 дней

Edwards and Eastwood (1992)58 

Манно-олигосахариды (MOS) 

Исследование in vitro с человеческими фекалиями

Избирательное увеличение производства пропионата

24ч

Asano et al. (2003)60 

Олиго-ламинараны

Исследование на крысах in vivo

SCFA с высоким содержанием в слепой кишке, особенно пропионата

28 дней

Asano et al. (2004)61 

Исследование in vitro с человеческими фекалиями

Повышенная выработка пропионата, антиканцерогенное действие на некоторые линии раковых клеток

NA 

Michel et al. (1999)62 

*Термин «избирательное увеличение» используется, когда произошло абсолютное увеличение производства пропионата. «Пропорциональное увеличение» используется в случае более высокого увеличения производства пропионата по сравнению с другими SCFA. Сокращение: NA - нет информации

L-рамноза

L-рамноза или 6-дезокси-L-манноза представляет собой природный дезокси-сахар. Он содержится в нескольких животных, растительных и бактериальных полисахаридах. Коммерчески доступную рамнозу получают путем химического гидролиза гуммиарабика и камеди карайи или из рутина или цитрусовых, которые содержат по массе 10–30% рамнозы. В краткосрочных экспериментах in vitro было показано, что L-рамноза увеличивает выработку пропионата в четыре раза по сравнению с количеством, продуцируемым лактулозой.43 Подобные результаты были получены в исследовании in vivo на человеке, в котором субъектам давали 25 г L-рамнозы, лактулозы, или D-глюкозы в трех разных случаях. Пропионовая кислота в сыворотке крови измерялась через 24 ч после приема внутрь и была значительно выше после L-рамнозы, чем после лактулозы или D-глюкозы.44 Пропионат-индуцирующий эффект L-рамнозы также был подтвержден в одном более длительном исследовании, в котором прием внутрь 25 г сахара значительно повышал содержание пропионата в сыворотке у людей в течение 28 дней по сравнению с приемом D-глюкозы в качестве контроля.

D-тагатоза

D-тагатоза является стереоизомером D-фруктозы, которая обычно используется в качестве альтернативы сахарозе из-за ее низкого содержания энергии.46 Неперевариваемость этого углевода в тонкой кишке и его высокая ферментируемость в толстой кишке свиней была изучена Laerke и Jensen.47 Помимо некоторых других метаболических эффектов, таких как более низкие уровни pH и более высокие концентрации АТФ в слепой кишке и проксимальном отделе толстой кишки, наблюдалось значительное увеличение содержания пропионата до 34,5 ммоль / л в слепой кишке и в некоторых сегментах толстого кишечника свиней, которым скармливали D-тагатозу (рацион 100 г/кг), по сравнению с контрольной группой, получавшей сахарозу.

Устойчивый (резистентный) крахмал

Резистентный крахмал состоит из большого количества единиц глюкозы, связанных между собой а-(1,4) или а-(1,6) гликозидными связями, и устойчив к деградации амилазой. В зависимости от происхождения крахмала его ферментируют до бутирата48 или пропионата.49 В частности, устойчивый крахмал из риса связан с увеличением производства пропионата. Ферментацию этого соединения в различных пропорциях исследовали на крысах Cheng и Lai. Установлено, что концентрация печеночных триглицеридов и общего холестерина у крыс, получавших рисовый крахмал (630 г/кг корма), была значительно ниже (в 1,5 раза), чем в контрольной группе без крахмала. Это происходило параллельно со значительным увеличением концентрации пропионата в сыворотке крови.

Инулин

Этот олигосахарид принадлежит к семейству фруктанов и в основном состоит из b-(2,1)-связанной фруктозил-фруктозы. Он естественным образом встречается в цветущих растениях, таких как цикорий и топинамбур, в качестве запасного углевода. В качестве пребиотика было показано, что инулин очень эффективен для увеличения выработки как бутирата, так и пропионата. Пропионат-увеличивающий эффект инулина был исследован in vitro с использованием симулятора кишечной микробной экосистемы человека (SHIME). Метаболический сдвиг для продукции SCFAs наблюдался после 1 недели приема инулина (5 г/сут). Более высокая концентрация SCFAs обусловлена ​​увеличением производства пропионата и бутирата.50 При введении в один и тот же реактор SHIME олигофруктозы и инулина с различной степенью полимеризации (DP) (2–20 и 3–60 для олигофруктозы и инулина соответственно), привело к увеличению выработки пропионата для инулина в 2 раза по сравнению с начальным периодом.51 Исследование in vivo на крысах, получавших инулин (10%), также привело к значительному увеличению выработки пропионата до 58,4 ммоль / л.52

Полидекстроза

Полидекстроза представляет собой разветвленный, случайно полимеризованный полисахарид (DP, 6–32), который синтезируется главным образом из декстрозы и не переваривается в верхней части желудочно-кишечного тракта. Модуляция микробного состава толстой кишки и метаболической активности этим субстратом была исследована с использованием четырехэтапного симулятора толстой кишки.53 Наблюдалось значительное увеличение продукции SCFA, особенно для пропионата (22,9 ммоль / л) по сравнению с контрольным ксилитом сахара (8,3 ммоль / л).

Арабиноксиланы и арабиноксилановые олигосахариды

Арабиноксиланы являются основными некрахмальными полисахаридами, содержащимися во многих злаках, и входят в состав пищевых волокон.Арабиноксиланы состоят из b-(1,4)-связанных D-ксилопиранозильных остатков, к которым в виде боковых цепей присоединены L-арабинофуранозные звенья. Некоторые арабинозы можно заменить феруловой кислотой. В исследовании in vivo, проведенном Lopez et al.  сравнивали 54 крысы, получавших контрольную диету (содержащую 710 г/кг пшеницы), арабиноксилансодержащую диету (610 г/кг пшеничного крахмала плюс 100 г/кг кукурузного арабиноксилана) и дополненную холестерином диету (без или с 2 г/кг холестерина). Уровень рН в слепой кишке снизился с 7 до 6 из-за накопления SCFAs, особенно пропионовой кислоты (>45% в молярном проценте). Однако производство бутирата не пострадало.

Олигосахариды арабиноксилана получают гидролизом высокополимеризованных арабиноксиланов. Они характеризуются своей степенью полимеризации DP и средней степенью замещения арабинозы (DS).55 В исследовании Grootaert et al.56 пребиотический потенциал олигосахаридов арабиноксилана сравнивали с инулином в двух SHIME-реакторах (Simulator of Human Intestinal Microbial Ecosystem - Имитатор микробной экосистемы кишечника человека - ред.). Деградация олигосахаридов арабиноксилана и инулина в основном происходила в поперечном и восходящем отсеках реактора соответственно. Уровень лактата (5,5 ммоль/л) повышался в восходящей ободочной кишке при добавлении олигосахаридов арабиноксилана, в то время как уровень пропионата (5,1 мм/Л) значительно повышался в поперечной ободочной кишке. Сопутствующее снижение содержания лактата в поперечной ободочной кишке указывало на то, что пропионат частично образуется по акрилатному пути. Лечение инулином оказывало умеренное воздействие на уровень лактата, пропионата и бутирата.

Псиллиум или исфагула является источником растворимой клетчатки, обеспечивающей полисахариды, сравнимые с арабиноксиланами отрубей пшеницы, но с более высокой вариабельностью в составе боковых цепей и сцеплении.57 В исследовании на крысах in vivo влияние исфагулы (5%) на ферментацию в слепой кишке и толстой кишке сравнивали с пшеничными отрубями (10%). Было замечено, что ферментация исфагулы приводит к более высокой продукции SCFAs, особенно к увеличению количества пропионовой кислоты в слепой кишке и во всех фрагментах толстой кишки.58

Манноолигосахариды

Маннан - это один из представителей нерастворимых в воде гемицеллюлоз, состоящий из линейных или разветвленных полимеров, полученных из таких сахаров, как D-манноза, D-галактоза и D-глюкоза.59 Манноолигосахариды (MOSs) фракционируются путем термического гидролиза Маннана. Эти углеводы устойчивы к а-амилазе слюнных желез человека, искусственному желудочному соку, ферментам поджелудочной железы свиней и ферментам слизистой оболочки кишечника крыс.60 С использованием методов переваривания in vitro была исследована ферментация MOS (10%) фекальными бактериями человека. Было обнаружено, что из MOSs вырабатывается значительно более высокий уровень пропионата по сравнению с фруктоолигосахаридами и b-1,4-маннобиозой.60 Аналогичные результаты для кофейных MOSs были получены в исследовании на крысах in vivo.61 Добавление 5% MOSs в рационе в течение 28 дней привело к пропорциональному увеличению до 36,5 ммоль / л пропионата в слепой кишке.

Другие субстраты

Ламинараны представляют собой группу водорастворимых полисахаридов b-(1,3)-D-глюкана с низкой молекулярной массой, выделенных из морских водорослей. Michel et al.62 исследовали биологическую активность и ферментационные характеристики олигосахаридов, полученных из ламинаранов. Олиголаминараны (как потенциальный пребиотик) индуцировали продукцию пропионата и демонстрировали антипролиферативное действие на колоректальный рак (Caco-2), моноцитарные (THP1) и лимфоцитарные Т-клеточные линии (Jurkat).62 

МЕХАНИЗМЫ ОБРАЗОВАНИЯ ПРОПИОНАТА

Пропионат, полученный в результате микробной ферментации неперевариваемых углеводов в кишечнике, является основным источником пропионата, доступного в организме. Многочисленные исследования были сосредоточены на этом метаболите как продукте кишечного брожения,7,45,49,52,54,63,64 а не от диетического приема пищи.16,25 Поэтому следующий раздел этого обзора включает подробное обсуждение двух основных путей производства пропионата в кишечнике и основных видов микроорганизмов, участвующих в этих специфических путях. Также проиллюстрированы взаимодействия между бактериями в пропионатных путях и современные стратегии обнаружения и идентификации пропионат-продуцирующих бактерий.

Сукцинат или рандомизирующий путь

Первый путь предполагает, что пропионат образуется путем декарбоксилирования симметричного соединения сукцината. Во-первых, оксалоацетат образуется пируваткарбоксилазой из пирувата (пируват - соль пировиноградной кислоты - ред.). Затем оксалоацетат восстанавливается до малата (малаты - соли и эфиры яблочной кислотыред.) малатдегидрогеназой с последующей дегидратацией малата до фумарата (фумараты - соли и эфиры фумаровой кислотыред.) фумаратгидратазой. Затем фумарат восстанавливается до сукцината (сукцинат – анион или соль янтарной кислоты – ред.) под действием сукцинатдегидрогеназы. Предполагается, что дальнейший метаболизм сукцината в пропионат происходит за счет декарбоксилирования метилмалонила-КоА, который преобразуется в пропионил-КоА с помощью метилмалонил-КоА-мутазы (Рис.1).

 Образование пропионата через сукцинат или рандомизирующий путь

Рисунок 1. Образование пропионата через сукцинат или рандомизирующий путь, основанный на Macyetal.66 Ферменты, участвующие в вышеуказанных реакциях: 1) пируваткарбоксилаза, 2) малатдегидрогеназа, 3) фумаратгидратаза, 4) сукцинатдегидрогеназа, 5) сукцинил-КоА-синтетаза, 6) метилмалонил-КоА-мутаза, 7) метилмалонил-КоА-эпимераза, 8) метилмалонил-КоА-декарбоксилаза, 9) пропионат-КоА-трансфераза.

Пути производства сукцината и пропионата были тщательно изучены в Bacteroides fragilis, важном анаэробе в кишечнике человека. Как правило, от 1010 до 1011 клеток этого вида обнаруживается на грамм кала.65 Для Bacteroides fragilis, Macy et al. 66 был предложен CO2-зависимый механизм выработки пропионата. Ферментативные анализы, проведенные с Bacteroides fragilis, показали, что образование оксалоацетата катализируется фосфоенолпируваткарбоксикиназой (PEP carboxykinase) и является энергетически независимым. Поэтому высокая энергия фосфатной связи в PEP сохраняется в виде АТФ при СО2-зависимом образовании оксалоацетата. Это в отличие от других видов, таких как Propionibacterium shermanii и Veillonella spp. в которой образование оксалоацетата катализируется транскарбоксилазой и пируваткиназой (оба АТФ-зависимых фермента) соответственно. В культуре активность сукцинатдегидрогеназы (Рис.1, фермент 4) зависела от присутствия гемина, железосодержащего соединения, необходимого для роста Bacteroides spp.64

Propionibacterium spp. является еще одним распространенным производителем пропионата, который использует сукцинатный путь. Декарбоксилирование сукцината является основным методом получения пропионата у пропионибактерий, поскольку количество образующейся пропионовой кислоты зависит от концентрации CO2 в среде. Более высокие соотношения пропионат:ацетат из-за повышенной концентрации CO2 объясняются бактериальной секрецией янтарной кислоты при значениях рН выше 6,5, но пока pH не упадет ниже этого уровня, клеточное поглощение невозможно. В случае увеличения концентрации СО2 образуется больше янтарной кислоты, причем избыток высвобождается в среду и декарбоксилируется только при снижении рН с глюкозой в качестве субстрата, что приводит к более высокому соотношению пропионат:ацетат.67

Механизм образования пропионата в Propionibacterium pentosaecum был исследован Delwiche.68 В этом исследовании продукция пропионата из сукцината была выше, чем из пирувата, и образовывались эквимолярные количества CO2 и пропионата. В том же исследовании, в присутствии 0,3 моль/л малоната, продукция пропионата была ингибирована на 90%. Учитывая эти наблюдения, становится очевидным, что Propionibacterium pentosaecum обладает сукцинатдекарбоксилазной системой, достаточно эффективной, чтобы считаться основным фактором для производства пропионата.

Декарбоксилирование сукцината обнаруживается в бесклеточных экстрактах Micrococcus lactilyticus в присутствии специфических кофакторов, таких как биотин и адениловая кислота. Бактерии Micrococcus lactilyticus (или Veillonella gazogenes) являются строго анаэробными бактериями, продуцирующими уксусную кислоту, пропионовую кислоту, CO2 и H2 посредством ферментации лактата. Они не способны ферментировать глюкозу, фруктозу, арабинозу и некоторые другие сахара, что может быть связано с отсутствием фермента, необходимого для первичного фосфорилирования глюкозы у этого вида69. Однако вымытые суспензии этого микроорганизма, выращенные на лактате были способны превращать пируват, оксалоацетат, L-малат, фумарат и сукцинат в анаэробных условиях.

Акрилатный путь

Хотя сукцинатный путь хорошо описан для некоторых из наиболее распространенных бактерий в кишечнике, было высказано предположение, что различия, наблюдаемые в паттернах распределения Меченого углерода, являются результатом другого механизма ферментации, отличного от сукцинатного пути.70 Этот путь определяется как акрилатный путь и представлен на Рис.2. В отличие от пути образования пропионата у Propionibacterium shermanii и Veillonella spp., где фумарат и сукцинат являются симметричными промежуточными звеньями, ни одно из промежуточных звеньев акрилатного пути не является симметричным.71 В акрилатном пути пируват восстанавливается до лактата лактатдегидрогеназой. Лактат превращается в лактил-КоА, который затем дегидратируется в акрилил-КоА с помощью 1-КоА-дегидратазы. Акрилил-КоА восстанавливается до пропионил-КоА с помощью ацил-КоА-дегидрогеназы. Фосфорилирование пропионил-КоА фосфат-ацетилтрансферазой приводит к пропионилфосфату, который в конечном итоге превращается в пропионат пропионат-киназой.

  Акрилатный путь в Clostridium neopropionicum X4

Рисунок 2. Акрилатный путь в Clostridium neopropionicum X4 на основе Tholozan et al.71 Ферменты, участвующие в вышеуказанных реакциях: 1) L-лактатдегидрогеназа, 2) пропионат-КоА-трансфераза, 3) лактоил-КоА-дегидратаза, 4) ацил-КоА-дегидрогеназа, 5) фосфат-ацетилтрансфераза, 6) пропионат-киназа.

Живой Clostridium neopropionicum X4 способен ферментировать [1-13C]этанол и CO2 в [2-13C]пропионат, [1-13C]ацетат и [2-13C]пропанол. Поскольку помеченные положения не изменились и молекулярный скелет был сохранен благодаря синтезу пропионата, было высказано предположение, что пропионат образуется не сукцинатом или путем рандомизации, а путем акрилата или нерандомизирующим путем.71.

Этот же путь был использован Megasphaera elsdenii (кластер IX клостридий). Последняя является важной обязательной анаэробной бактерией рубца крупного рогатого скота и овец, на долю которой приходится 21% потребления лактата бактериями рубца; она также обнаружена в кишечнике человека.73 Megasphaera elsdenii использовала лактат в предпочтении к глюкозе, когда эти два субстрата присутствовали для производства пропионата.74

ВЗАИМОДЕЙСТВИЯ МИКРООРГАНИЗМОВ

В сложном смешанном микробном сообществе сотрудничество между различными микроорганизмами для получения определенного конечного продукта не является редкостью. Например, Falony et al.75 показали, что существует существенное сотрудничество между Bifidobacteria и видами Roseburia для ферментации инулина в бутират. Это сотрудничество осуществляется посредством перекрестного питания, при котором один вид усваивает продукты другого вида. Следующие примеры предполагают, что подобное сотрудничество между рубцовыми бактериями приводит к производству пропионата. В рубце обнаружено, что некоторые виды бактерий способны выполнять все стадии в путях пропионата, используя углеводы в качестве субстрата для образования пропионата. Примеры включают Megasphaera elsdenii и Selenomonas ruminantium, которые производят пропионат из углеводов и лактата через акрилатный и сукцинатный пути, соответственно.74,76 С другой стороны, некоторые виды бактерий рубца, такие как Ruminococcus flavefaciens и Bacteroides succinogenes, производят сукцинат только в качестве основного конечного продукта ферментации при культивировании в чистой культуре. У таких видов было замечено, что сукцинат не накапливается в рубце, а декарбоксилируется до пропионата. Поэтому было высказано предположение, что сукцинат, производимый таким видом, как Bacteroides succinogenes, превращается в пропионат видами, потребляющими сукцинат, такими как Selenomonas ruminantium.64

Другой пример микробного взаимодействия между двумя видами был представлен Hino et al.74. При выращивании отдельно в среде, содержащей глюкозу, монокультура Streptococcus bovis росла быстрее, чем Megasphaera elsdenii, но конечный выход клеток был ниже для Streptococcus bovis, чем для Megasphaera elsdenii. Однако, когда эти два вида культивировали вместе, скорость роста и концентрация клеток Streptococcus bovis были выше, чем у Megasphaera elsdenii. Значительное производство пропионата в этой совместной культуре указывает на то, что Megasphaera elsdenii потребляет лактат, продуцируемый Streptococcus bovis. Более сильный рост Streptococcus bovis позволяет предположить, что глюкоза была в основном ферментирована этим видом и что Megasphaera использовала мало глюкозы, когда лактат был доступен. Это означает, что на рост и выработку пропионата у Megasphaera elsdenii сильно влияет ферментация глюкозы и выработка лактата Streptococcus bovis.

Конкуренция за необходимое питательное вещество является одним из негативных взаимодействий, которые происходят между микроорганизмами в смешанном сообществе. Водород (H2) является основным промежуточным продуктом в кишечной ферментации. Он используется гидрогенотрофными микроорганизмами, принадлежащими в основном к метаногенам, ацетогенам и сульфатредуцирующим бактериям. Таким образом, эти микроорганизмы конкурируют за Н2 и влияют на рост и активность друг друга. Метаногены используют водород для уменьшения CO2 и получения метана (CH4). Последнее рассматривается как потеря энергии для хозяина и вклад в глобальное потепление.77 Использование бактериальных взаимодействий уже было стратегией снижения метаногенеза в исследованиях in vitro, а также in vivo. Одним из способов снижения метаногенеза является индукция путей ферментации, в которых H2 используется другими микроорганизмами. Ацетогенез, по-видимому, является возможной альтернативой сокращению производства СН4 метаногенами. В исследовании, проведенном Morvan и соавторами,78 взаимодействия in vitro между микроорганизмом, продуцирующим H2 в рубце, Ruminococcus flavefaciens, и бактериями, утилизирующими H2, принадлежащими к кластеру XIV Clostridia, приводили к более высокой продукции ацетата Clostridium в среде для культивирования. Это указывало на межвидовой перенос Н2, приводящий к меньшей доступности Н2 для метаногенов. Вторая возможность восстановления CH4 - образование пропионата. Некоторые производители пропионата образуют пропионат через сукцинатный путь, в котором участвуют такие промежуточные продукты, как малат и фумарат. В исследовании Lopez et al.,79 было продемонстрировано, что добавление фумарата натрия (6,25 ммоль / день) в ферментационную среду с микробиотой рубца значительно уменьшило, на 6%, количество продуцируемого CH4. Уменьшение хорошо соответствовало фракции фумарата, которая была превращена в пропионат. Дополнительные доказательства обратной связи между производством пропионата и метаногенезом, а также некоторые стратегии снижения содержания метана в рубце рассматриваются Boadi et al.77 однако основная информация о влиянии пропионата на метаногенез, по-видимому, была получена в результате исследований на животных и главным образом в рубце. Поэтому было бы интересно исследовать этот эффект и в кишечнике человека.

Сульфатредуцирующие бактерии используют Н2 для уменьшения содержания серы в неабсорбированных аминокислотах и пищевых сульфатах. Сульфид главным образом детоксифицируется в толстой кишке и эритроцитах путем метилирования тиолметилтрансферазой.80 Тем не менее, была обнаружена важная роль сульфида толстой кишки в патогенезе язвенного колита (ЯК). У пациентов с ЯК отмечается более высокая продукция сероводорода и ростовые характеристики сульфатредуцирующих бактерий по сравнению с контрольными группами.80 Это связано с избирательно нарушенным окислением бутирата, который играет существенную роль в поддержании здоровья эпителиального барьера толстой кишки. До сих пор стратегии снижения содержания сероводорода включали антибиотики против сульфатредуцирующих бактерий, доноров метила, диетическое сокращение потребления сульфидов и стимулирование метаногенеза толстой кишки.80 Помимо этих стратегий, потенциальное влияние пропионата на смягчение сероводорода посредством диетического регулирования представляло бы интерес для изучения.

МОЛЕКУЛЯРНЫЙ МОНИТОРИНГ БАКТЕРИЙ, ПРОДУЦИРУЮЩИХ ПРОПИОНАТ

Более 90% бактерий, обитающих в кишечнике человека, не поддаются культивированию.81 Молекулярные методы с использованием 16S-рибосомных РНК-зондов82 или праймеров для полимеразной цепной реакции83 были использованы в качестве мощных независящих от культуры методов для выявления преобладающих бактериальных групп, присутствующих в кишечнике человека. Для продуцентов пропионата, а также других бактериальных групп ген рибосомальной РНК 16S в основном использовался для разработки генетически ориентированных видоспецифичных праймеров. Обзор праймеров, которые подходят для обнаружения нескольких известных продуцентов пропионата, перечислены в таблице 3. Совсем недавно гены, участвующие в метаболических путях, таких как производство SCFAs бактериями, стали новыми мишенями в молекулярном анализе. Чтобы проиллюстрировать этот момент, приведем исследование Louis et al.84 сообщившем о разработке праймеров полимеразной цепной реакции с использованием генов, кодирующих конечные ферменты синтеза бутирата в толстом кишечнике человека. Гены, кодирующие бутираткиназу, фосфотрансбутирилазу и бутирил-КоА: ацетат КоА-трансферазу, использовали для оценки способности бактерий продуцировать ферменты, участвующие в производстве бутирата. Кроме того, можно изучить преобладающий путь образования бутирата в кишечнике.

Таблица 3. ПЦР-праймеры для обнаружения пропионат-продуцирующих бактерий.

Кандидат
Последовательность
праймеров
Размер продукта (п.н.)
Темпера-тура отжига (°С)
Ref.
Bacteroides fragilis subgroup 
ATACGGAGGATCCGAGCGTTA

CTGTTTGATACCCACACT 
293
65
Vanhoutte et al. (2006)86
Bacteroides fragilis group 
ATAGCCTTTCGAAAGRAAGAT

CCAGTATCAACTGCAATTTTA 
501
50
Matsuki et al. (2002)83
Prevotella ruminicola 
GGTTATCTTGAGTT

CTGATGGCAACTAAAGAA 
485
53
Tajima et al. (2001) 87
Prevotella ruminicola 23 
GAAAGTCGGATTAATGCTCTATGTTG

CATCCTATAGCGGTAAACCTTTGG 
74
53
Stevens and Weimer (2007)88
Selenomonas ruminantium D 
CAATAAGCATTCCGCCTGGG

TTCACTCAATGTCAAGCCCTGG 
138
56
Stevens and Weimer (2007)88
Megasphaera elsdenii T81 
AGATGGGGACAACAGCTGGA

CGAAAGCTCCGAAGAGCCT 
95
54
Stevens and Weimer (2007)88
Bacteroides vulgatus 
GCATCATGAGTCCGCATGTTC

TCCATACCCGACTTTATTCCTT 
287
50
Wang et al. (1996)89
Escherichia coli 
GACCTCGGTTTAGTTCACAGA

CACACGCTGACGCTGACCA 
585
50
Wang et al. (1996)89
Propionibacterium freudenreichii 
CTTTCATCCATGACGAAGCGCAAG

TGGGGTCGAGTTGCAGACCCCAAT 
867
69
Rossi et al. (1999)90
Propionibacterium acidipropionici 
GACGAAGGCATTCTTTTAGGGTGT

TGGGGTCGAGTTGCAGACCCCAAT 
868
68
Rossi et al. (1999)90

Используя аналогичный подход, Asanuma и Hino85 выяснили механизм регуляции продукции пропионата в Selenomonas ruminantium путем нацеливания на гены фосфоенолпируваткарбоксикиназы и пируваткиназы, которые оба участвуют в ранних стадиях синтеза пропионата. Такая стратегия исследования может также применяться к обнаружению других пропионат-продуцирующих бактерий. Кроме того, конечные ферменты в путях образования пропионата (рисунки 1 и 2) могут быть использованы для 1) скрининга более широкого диапазона филогенетически разнообразных продуцирующих пропионат бактерий из толстой кишки человека и 2) определения степени, в которой пути производства пропионата используются в этой экосистеме.

Необходимы дальнейшие исследования для расширения набора праймеров для обнаружения генов, кодирующих ферменты, участвующие в путях производства пропионата, а также для определения и количественной оценки микроорганизмов, продуцирующих пропионат. Чтобы помочь в разработке такой молекулярно-аналитической стратегии, здесь представлен обзор ферментов, участвующих либо в сукцинатном, либо в акрилатном путях производства пропионата. Можно запросить эти ферменты в базе данных последовательности ДНК Банка генов из Национального центра биотехнологической информации (NCBI), чтобы найти кодирующие гены. Для иллюстрации был проведен поиск на основе номера комиссии по ферментам (EC number) и с исключением архей. За исключением одного фермента, который участвует в акрилатном пути, лактоил-КоА-дегидратазы, запрос на различные ферменты привел к большому количеству видов, обладающих генами, включая предполагаемые гены, экспрессирующие эти ферменты (таблица 4). Интересно отметить, что число видов бактерий, обладающих специфическими ферментами, сильно варьировало. Для ферментов, участвующих в сукцинатном пути, наблюдалось увеличение числа видов, которые обладают ферментами, вовлеченными в цепь транспорта электронов (Таблица 4; Рисунок 1, ферменты 1, 2, 3, 4 и 5). Далее вниз по течению, уменьшающееся число видов будет обладать способностью производить ферменты, участвующие в последних стадиях образования пропионата (Таблица 4; Рисунок 1, ферменты 6, 7, 8 и 9). Одним из возможных объяснений этой тенденции является пробел в информации о видах бактерий, участвующих в начальной или конечной стадиях производства пропионата. Альтернативно, вероятно, что только ограниченное число бактериальных видов способны выполнять заключительные метаболические шаги в пути производства пропионата. Напротив, такой тенденции не наблюдалось для ферментов, вовлеченных в акрилатный путь. Что касается сукцинатного пути, информация о количестве видов, обладающих соответствующими ферментами, может быть неполной.

Таблица 4. Результаты NCBI поиска ферментов, участвующих в путях производства пропионата.

Фермент
Количество видов бактерий
Сукцинатный путь
6.4.1.1
243
1.1.1.37
656
4.2.1.2
834
1.3.99.1
1,443
6.2.1.5
1,133
5.4.99.2
466
5.1.99.1
99
4.1.1.41
47
2.8.3.1
25
Акрилатный путь
1.1.1.27
245
2.8.3.1
25
1.3.99.3
424
2.3.1.8
625
2.7.2.15
34

В дополнение к выполнению поиска, бактериальные роды были ранжированы на основе общего количества ферментов, которые могут быть связаны либо с сукцинатным, либо с акрилатным путем. Это обеспечивает лучшее представление о конкретных бактериальных родах, которые имеют более высокую вероятность производства пропионата. Все бактериальные роды, обладающие ферментами для сукцинатного и акрилатного путей, представлены в виде дополнительных таблиц S1 и S2 в качестве вспомогательной информации. (Таблица S1. Ранжирование бактерий основано на общем количестве генов, кодирующих ферменты, участвующие в сукцинатном пути. Приведено кол-во видов, обладающих ферментами для каждого рода. Таблица 2. Ранжирование бактерий основано на общем количестве ферментов, участвующих в акрилатном пути. Приведено кол-во видов, обладающих ферментами для каждого рода. – ред.) В этих таблицах можно ознакомиться со всем категорированным списком бактериальных родов с общим количеством ферментов. Кроме того, в вспомогательных таблицах представлено количество видов для каждого конкретного фермента. Повторения одного и того же бактериального рода и вида происходят из-за наличия нескольких штаммов одного и того же вида или из-за наличия различной номенклатуры для одного и того же гена в пределах одного вида. Хорошо известно, что некоторые из этих родов присутствуют в кишечнике человека, такие как Veilonella, Lactobacillus, Bacteroides и Propionibacterium. Однако существует много других родов, для которых определяются функциональные гены, но необходимы дальнейшие исследования, чтобы выяснить, можно ли обнаружить эти виды в кишечнике человека.

ЗАКЛЮЧЕНИЕ

Известно, что пропионат кишечного микробного происхождения обладает биологической активностью на уровне кишечника и кишечного эпителия. Тем не менее, благодаря его эффективному переносу через эпителий кишечника, он может влиять на другие органы и ткани в дополнение к кишечному эпителию. Это открывает потенциал для модуляции воздействия этого метаболита на здоровье через кишечник. Селективные изменения концентрации пропионата в сыворотке крови достигаются путем подачи специфических ферментируемых субстратов. Эти изменения отражают различия в продукции толстой кишки и микробном составе. Таким образом, селективное изменение схемы ферментации толстой кишки с использованием функциональных продуктов питания может привести к новой стратегии модуляции эффектов пропионата на здоровье. Хотя сообщалось, что многие пребиотические соединения стимулируют выработку пропионата кишечными микроорганизмами, механизмы, лежащие в основе производства пропионата, нуждаются в дальнейшем разъяснении. Из-за больших межиндивидуальных различий в составе и связанном метаболизме микробного сообщества кишечника знание структуры углеводов недостаточно для того, чтобы предсказать, будет ли пропионат основным метаболитом ферментации после потребления пребиотиков. Поэтому предлагается, чтобы исследования были направлены на изучение микробных метаболических путей, которые приводят к производству пропионата. Перекрестные реакции питания между кишечными микроорганизмами должны быть полностью раскрыты, и необходимо оценить важность сукцинатного пути и/или акрилатного пути для производства пропионата в микробном консорциуме. Эти цели могут быть достигнуты путем применения новых молекулярных инструментов, основанных на видоспецифичных праймерах. Кроме того, функциональный генный подход к выявлению и количественному определению продуцирующей пропионат микробиоты в сложных условиях кишечной среды является сложным, но многообещающим шагом при проверке потенциала новых функциональных пищевых продуктов (пробиотиков и пребиотиков) для увеличения производства пропионата в кишечнике.

Дополнительная информация

Литература

  1. Guarner F, Malagelada JR. Gut flora in health and disease. Lancet. 2003;361:512–519.
  2. Noverr MC, Huffnagel GB. Does the microbiota regulate immune responses outside the gut? Trends Microbiol. 2004;12:562–568.
  3. Backhed F, Ding H, Wang T, et al. The gut microbiota as an environmental factor that regulates fat storage. Proc Natl Acad Sci U S A. 2004;101:15718–15723.
  4. Lim CC, Ferguson LR, Tannock GW. Dietary fibers as “prebiotics”: implications for colorectal cancer. Mol Nutr Food Res. 2005;49:609–619.
  5. Cummings JH. Short chain fatty-acids in the human-colon. Gut. 1981;22:763–779.
  6. Scheppach W. Effects of short-chain fatty-acids on gut morphology and function. Gut. 1994;35:35–38.
  7. Roediger WEW. Role of anaerobic-bacteria in the metabolic welfare of the colonic mucosa in man. Gut. 1980;21:793–798.
  8. Milovic V, Teller IC, Turchanowa L, Caspary WF, Stein J. Effect of structural analogues of propionate and butyrate on colon cancer cell growth. Int J Colorectal Dis. 2000;15:264–270.
  9. Vecchia MG, Carnelos M, Fellipe CRC, Curi R, Newsholme EA. Acetate and propionate potentiate the antiproliferative effect of butyrate on RBL-2H3 growth. Gen Pharmacol. 1997;29:725–728.
  10. Li CJ, Elsasser TH. Butyrate-induced apoptosis and cell cycle arrest in bovine kidney epithelial cells: involvement of caspase and proteasome pathways. J Anim Sci. 2005;83:89–97.
  11. Lin YG, Vonk RJ, Slooff MJH, Kuipers F, Smit MJ. Differences in propionate-induced inhibition of cholesterol and triacylglycerol synthesis between human and rat hepatocytes in primary culture. Br J Nutr. 1995;74:197–207.
  12. Nishina PM, Freedland RA. Effects of propionate on lipid biosynthesis in isolated rat hepatocytes. J Nutr. 1990;120:668–673.
  13. Miyazaki T, Ohura T, Kobayashi M, et al. Fatal propionic academia in mice lacking propionyl-CoA carboxylase and its rescue by postnatal, liver-specific supplementation via a transgene. J Biol Chem. 2001;276:35995–35999.
  14. Delzenne NM, Williams CM. Prebiotics and lipid metabolism. Curr Opin Lipidol. 2002;13:61–67.
  15. Oba M, Allen MS. Intraruminal infusion of propionate alters feeding behavior and decreases energy intake of lactating dairy cows. Paper presented at: Annual Meeting of the American-Dairy-Science-Association; Indianapolis, Indiana; Jul, 2001.
  16. Ruijschop R, Boelrijk AEM, Giffel MCT. Satiety effects of a dairy beverage fermented with propionic acid bacteria. Int Dairy J. 2008;18:945–950.
  17. Zhou J, Martin RJ, Tulley RT, et al. Dietary resistant starch upregulates total GLP-1 and PYY in a sustained day-long manner through fermentation in rodents. Am J Physiol Endocrinol Metab. 2008;295:1160–1166.
  18. Jan G, Belzacq AS, Haouzi D, et al. Propionibacteria induce apoptosis of colorectal carcinoma cells via short-chain fatty acids acting on mitochondria. Cell Death Differ. 2002;9:179–188.
  19. Cummings JH, Pomare EW, Branch WJ, Naylor CPE, Macfarlane GT. Short chain fatty-acids in human largeintestine, portal, hepatic and venous-blood. Gut. 1987;28:1221–1227.
  20. Xiong YM, Miyamoto N, Shibata K, et al. Short-chain fatty acids stimulate leptin production in adipocytes through the G protein-coupled receptor GPR41. Proc Natl Acad Sci U S A. 2004;101:1045–1050.
  21. Anderson JW, Chen WJL. Plant fiber-carbohydrate and lipidmetabolism. Am J Clin Nutr. 1979;32:346–363.
  22. Story JA. The role of dietary fiber in lipid metabolism. Adv Lipid Res. 1981;18:229–246.
  23. Illman RJ, Topping DL, McIntosh GH, et al. Hypocholesterolemic effects of dietary propionate-studies in whole animals and perfused rat-liver. Ann Nutr Metab. 1988;32:97–107.
  24. Adam A, Levrat-Verny MA, Lopez HW, Leuillet M, Demigne C, Remesy C. Whole wheat and triticale flours with differing viscosities stimulate cecal fermentations and lower plasma and hepatic lipids in rats. J Nutr. 2001;131:1770–1776.
  25. Todesco T, Rao AV, Bosello O, Jenkins DJA. Propionate lowers blood-glucose and alters lipid-metabolism in healthysubjects. Am J Clin Nutr. 1991;54:860–865.
  26. Beaulieu KE, McBurney MI. Changes in pig serum-lipids, nutrient digestibility and sterol excretion during cecal infusion of propionate. J Nutr. 1992;122:241–245.
  27. Wolever TMS, Spadafora P, Eshuis H. Interaction between colonic acetate and propionate in humans. Am J Clin Nutr. 1991;53:681–687.
  28. Gee JM, Johnson IT. Dietary lactitol fermentation increases circulating peptide YY and glucagon-like peptide-1 in rats and humans. Nutrition. 2005;21:1036–1043.
  29. Delzenne NM, Cani PD, Daubioul C, Neyrinck AM. Impact of inulin and oligofructose on gastrointestinal peptides. Br J Nutr. 2005;93:157–161.
  30. Delzenne NM, Daubioul C, Neyrinck A, Lasa M, Taper HS. Inulin and oligofructose modulate lipid metabolism in animals: review of biochemical events and future prospects. Br J Nutr. 2002;87:255–259.
  31. Meier U, Gressner AM. Endocrine regulation of energy metabolism: review of pathobiochemical and clinical chemical aspects of leptin, ghrelin, adiponectin, and resistin. Clin Chem. 2004;50:1511–1525.
  32. Cani PD, Delzenne NM. Gut microflora as a target for energy and metabolic homeostasis. Curr Opin Clin Nutr. 2007;10:729–734.
  33. Lahham SH, Weening D, Rezaee F, Roelofsen H, Venema K, Vonk RJ. Propionic acid stimulates leptin production in human adipose tissue through G-protein coupled receptor(s). Paper presented at: 10th Annual Gutday, 2008; University Medical Centre Utrecht and Gut flora Fundation, The Netherlands. 2008.
  34. Scheppach W, Bartram HP, Richter F. Role of short-chain fatty-acids in the prevention of colorectal-cancer. Eur J Cancer. 1995;31A:1077–1080.
  35. Hamer HM, Jonkers D, Venema K, Vanhoutvin S, Troost FJ, Brummer RJ. Review article: the role of butyrate on colonic function. Aliment Pharmacol Ther. 2008;27:104–119.
  36. KosakaM, Takeda M, Matsumoto K, Nishimune Y. F9-cells can be differentiated toward 2 distinct, mutually exclusive pathways by retinoic acid and sodium-butyrate. Dev Growth Differ. 1994;36:223–230.
  37. Hague A, Elder DJ, Hicks DJ, Paraskeva C. Apoptosis in colorectal tumour cells: induction by the short chain fatty acids butyrate, propionate and acetate and by the bile salt deoxycholate. Int J Cancer. 1995;60:400–406.
  38. 38.  Matthews GM. Short-Chain Fatty Acid Modulation of Apoptosis in Gastric and Colon Cancer Cells. Adelaide, SA: Department of Philosophy, The University of Adelaide; 2007.
  39. Chambers AF, Groom AC, MacDonald IC. Dissemination and growth of cancer cells in metastatic sites. Nat Rev Cancer. 2002;2:563–572.
  40. Gibson GR, Roberfroid MB. Dietary modulation of the human colonic microbiota-introducing the concept of prebiotics. J Nutr. 1995;125:1401–1412.
  41. Kien CL, Blauwiekel R. Cecal infusion of butyrate does not alter cecal concentration of butyrate in piglets fed inulin. JPEN J Parenter Enteral Nutr. 2008;32:439–442.
  42. Janczyk P, Pieper R, Smidt H, Souffrant WB. Effect of alginate and inulin on intestinal microbial ecology of weanling pigs reared under different husbandry conditions. FEMSMicrobiol Ecol. 2009;72:132–142.
  43. Fernandes J, Rao AV, Wolever TMS. Different substrates and methane producing status affect short-chain fatty acid profiles produced by in vitro fermentation of human feces. J Nutr. 2000;130:1932–1936.
  44. Vogt JA, Pencharz PB, Wolever TMS. L-rhamnose increases serum propionate in humans. Am J Clin Nutr. 2004;80:89– 94.
  45. Vogt JA, Ishii-Schrade KB, Pencharz PB, Wolever TMS. L-rhamnose increases serum propionate after long-term supplementation, but lactulose does not raise serum acetate. Am J Clin Nutr. 2004;80:1254–1261.
  46. Levin GV, Zehner LR, Saunders JP, Beadle JR. Sugar substitutes– their energy values, bulk characteristics, and potential health benefits. Am J Clin Nutr. 1995;62:1161–1168.
  47. Laerke HN, Jensen BB. D-tagatose has low small intestinal digestibility but high large intestinal fermentability in pigs. J Nutr. 1999;129:1002–1009.
  48. Brouns F, Kettlitz B, Arrigoni E. Resistant starch and “the butyrate revolution.” Trends Food Sci Technol. 2002;13:251–261.
  49. Cheng HH, Lai MH. Fermentation of resistant rice starch produces propionate reducing serum and hepatic cholesterol in rats. J Nutr. 2000;130:1991–1995.
  50. Van DeWiele T, Boon N, Possemiers S, Jacobs H, VerstraeteW. Prebiotic effects of chicory inulin in the simulator of the human intestinal microbial ecosystem. FEMS Microbiol Ecol. 2004;51:143–153.
  51. Van DeWiele T, Boon N, Possemiers S, Jacobs H, VerstraeteW. Inulin-type fructans of longer degree of polymerization exert more pronounced in vitro prebiotic effects. J Appl Microbiol. 2007;102:452–460.
  52. Levrat MA, Remesy C, Demigne C. High propionic-acid fermentations and mineral accumulation in the cecum of rats adapted to different levels of inulin. J Nutr. 1991;121:1730–1737.
  53. Makelainen HS, Makivuokko HA, Salminen SJ, Rautonen NE, Ouwehand AC. The effects of polydextrose and xylitol on microbial community and activity in a 4-stage colon simulator. J Food Sci. 2007;72:153–159.
  54. Lopez HW, Levrat MA, Guy C, Messager A, Demigne C, Remesy C. Effects of soluble corn bran arabinoxylans on cecal digestion, lipid metabolism, and mineral balance (Ca, Mg) in rats. J Nutr Biochem. 1999;10:500–509.
  55. Swennen K, Courtin CM, Lindemans G, Delcour JA. Largescale production and characterisation of wheat bran arabinoxylooligosaccharides. J Sci Food Agric. 2006;86:1722–1731.
  56. Grootaert C, Van den Abbeele P, Marzorati M, et al. Comparison of prebiotic effects of arabinoxylan oligosaccharides and inulin in a simulator of the human intestinal microbial ecosystem. FEMS Microbiol Ecol. 2009;69:231–242.
  57. Edwards S, Chaplin MF, Blackwood AD, Dettmar PW. Primary structure of arabinoxylans of ispaghula husk and wheat bran. Proc Nutr Soc. 2003;62:217–222.
  58. Edwards CA, EastwoodMA. Comparison of the effects of ispaghula and wheat bran on rat cecal and colonic fermentation. Gut. 1992;33:1229–1233.
  59. Moreira LRS, Filho EXF. An overview of mannan structure and mannan-degrading enzyme systems. Appl Microbiol Biotechnol. 2008;79:165–178.
  60. Asano I, Hamaguchi K, Fujii S, Iino H. In vitro digestibility and fermentation of mannooligosaccharides from coffee mannan. Food Sci Technol Res. 2003;9:62–66.
  61. Asano I, Ikeda Y, Fujii S, Iino H. Effects of mannooligosaccharides from coffee on microbiota and short chain fatty acids in rat cecum. Food Sci Technol Res. 2004;10:273–277.
  62. Michel C, Benard C, Lahaye M, et al. Algal oligosaccharides as functional foods: in vitro study of their cellular and fermentative effects. Sci Aliments. 1999;19:311–332.
  63. Campbell JM, Fahey GC, Wolf BW. Selected indigestible oligosaccharides affect large bowel mass, cecal and fecal shortchain fatty acids, pH and microflora in rats. J Nutr. 1997;127:130–136.
  64. Scheifin CC, Wolin MJ. Propionate formation from cellulose and soluble sugars by combined cultures of Bacteroides succinogenes and Selenomonas ruminantium. Appl Microbiol. 1973;26:789–795.
  65. Macy J, Probst I, Gottschalk G. Evidence for cytochrome involvement in fumarate reduction and adenosine 5`-triphosphate synthesis by Bacteroides fragilis grown in presence of hemin. J Bacteriol. 1975;123:436–442.
  66. Macy JM, Ljungdahl LG, Gottschalk G. Pathway of succinate and propionate formation in Bacteroides fragilis. J Bacteriol. 1978;134:84–91.
  67. Johns AT. The mechanism of propionic acid formation by Propionibacteria. J Gen Microbiol. 1951;5:337–345.
  68. Delwiche EA. Mechanism of propionic acid formation by Propionibacterium pentosaceum. J Bacteriol. 1948;56:811–820.
  69. Whiteley HR. The mechanism of propionic acid formation by succinate decarboxylation. I. The activation of succinate. Biochemistry. 1953;39:772–779.
  70. Wood HG, Stjernholm R, Leaver FW. The Role of succinate as a precursor of propionate in the propionic acid fermentation. J Bacteriol. 1956;72:142–152.
  71. Tholozan JL, Touzel JP, Samain E, Grivet JP, Prensier G, Albagnac G. Clostridium neopropionicum sp nov, a strict anaerobic bacterium fermenting ethanol to propionate through acrylate pathway. Arch Microbiol. 1992;157:249–257.
  72. Marounek M, Fliegrova K, Bartos S. Metabolism and some characteristics of ruminal strains of Megasphaera elsdenii. Appl Environ Microbiol. 1989;55:1570–1573.
  73. Brancaccio M, Legendre GG. Megasphaera elsdenii endocarditis. J Clin Microbiol. 1979;10:72–74.
  74. Hino T, Shimada K, Maruyama T. Substrate preference in a strain of Megasphaera elsdenii, a ruminal bacterium, and its implications in propionate production and growth competition. Appl Environ Microbiol. 1994;60:1827–1831.
  75. Falony G, Vlachou A, Verbrugghe K, De Vuyst L. Cross-feeding between Bifidobacterium longum BB536 and acetateconverting, butyrate-producing colon bacteria during growth on oligofructose. Appl Environ Microbiol. 2006;72: 7835–7841.
  76. Paynter MJB, Elsden SR. Mechanism of propionate formation by Selenomonas ruminantium, a rumen microorganism. J Gen Microbiol. 1970;61:1–7.
  77. Boadi D, Benchaar C, Chiquette J, Masse D. Mitigation strategies to reduce enteric methane emissions from dairy cows: update review. Can J Anim Sci. 2004;84:319–335.
  78. Morvan B, RieuLesme F, Fonty G, Gouet P. In vitro interactions between rumen H2-producing cellulolytic microorganisms and H2-utilizing acetogenic and sulfate-reducing bacteria. Anaerobe. 1996;2:175–180.
  79. Lopez S, Valdes C, Newbold CJ, Wallace RJ. Influence of sodium fumarate addition on rumen fermentation in vitro. Br J Nutr. 1999;81:59–64.
  80. Roediger WEW, Moore J, Babidge W. Colonic sulfide in pathogenesis and treatment of ulcerative colitis. Dig Dis Sci. 1997;42:1571–1579.
  81. Backhed F, Ley RE, Sonnenburg JL, Peterson DA, Gordon JI. Host-bacterial mutualism in the human intestine. Science. 2005;307:1915–1920.
  82. Sghir A, Gramet G, Suau A, Rochet V, Pochart P, Dore J. Quantification of bacterial groups within human fecal flora by oligonucleotide probe hybridization. Appl Environ Microbiol. 2000;66:2263–2266.
  83. Matsuki T,Watanabe K, Fujimoto J, et al. Development of 16S rRNA-gene-targeted group-specific primers for the detection and identification of predominant bacteria in human feces. Appl Environ Microbiol. 2002;68:5445–5451.
  84. Louis P, Duncan SH, McCrae SI, Millar J, Jackson MS, Flint HJ. Restricted distribution of the butyrate kinase pathway among butyrate-producing bacteria from the human colon. J Bacteriol. 2004;186:2099–2106.
  85. Asanuma N, Hino T. Molecular characterization, enzyme properties and transcriptional regulation of phosphoenolpyruvate carboxykinase and pyruvate kinase in a ruminal bacterium, Selenomonas ruminantium. Microbiology. 2001; 147:681–690.
  86. Vanhoutte T, De Preter V, De Brandt E, Verbeke K, Swings J, Huys G. Molecular monitoring of the fecal microbiota of healthy human subjects during administration of lactulose and Saccharomyces boulardii. Appl Environ Microbiol. 2006;72:5990–5997.
  87. Tajima K, Aminov RI, Nagamine T, Matsui H, Nakamura M, Benno Y. Diet-dependent shifts in the bacterial population of the rumen revealed with real-time PCR. Appl Environ Microbiol. 2001;67:2766–2774.
  88. Stevenson DM, Weimer PJ. Dominance of Prevotella and low abundance of classical ruminal bacterial species in the bovine rumen revealed by relative quantification real-time PCR. Appl Microbiol Biotechnol. 2007;75:165–174.
  89. Wang RF, Cao WW, Cerniglia CE. PCR detection and quantification of predominant anaerobic bacteria in human and animal fecal samples. Appl Environ Microbiol. 1996;62:1242–1247.
  90. Rossi F, Torriani S, Dellaglio F. Genus- and species-specific PCR-based detection of dairy Propionibacteria in environmental samples by using primers targeted to the genes encoding 16S rRNA. Appl Environ Microbiol. 1999;65:4241–4244.

Будьте здоровы!

 

ССЫЛКИ К РАЗДЕЛУ О ПРЕПАРАТАХ ПРОБИОТИКАХ

  1. ПРОБИОТИКИ
  2. ДОМАШНИЕ ЗАКВАСКИ
  3. БИФИКАРДИО
  4. КОНЦЕНТРАТ БИФИДОБАКТЕРИЙ ЖИДКИЙ
  5. ПРОПИОНИКС
  6. ЙОДПРОПИОНИКС
  7. СЕЛЕНПРОПИОНИКС
  8. МИКРОЭЛЕМЕНТНЫЙ СОСТАВ
  9. ПРОБИОТИКИ С ПНЖК
  10. БИФИДОБАКТЕРИИ
  11. ПРОПИОНОВОКИСЛЫЕ БАКТЕРИИ
  12. ПРОБИОТИКИ И ПРЕБИОТИКИ
  13. СИНБИОТИКИ
  14. РОЛЬ МИКРОБИОМА В ТЕРАПИИ РАКА
  15. АНТИОКСИДАНТНЫЕ СВОЙСТВА
  16. АНТИОКСИДАНТНЫЕ ФЕРМЕНТЫ
  17. АНТИМУТАГЕННАЯ АКТИВНОСТЬ
  18. МИКРОФЛОРА КИШЕЧНОГО ТРАКТА
  19. МИКРОБИОМ ЧЕЛОВЕКА
  20. МИКРОФЛОРА И ФУНКЦИИ МОЗГА
  21. ПРОБИОТИКИ И ХОЛЕСТЕРИН
  22. ПРОБИОТИКИ ПРОТИВ ОЖИРЕНИЯ
  23. МИКРОФЛОРА И САХАРНЫЙ ДИАБЕТ
  24. ПРОБИОТИКИ и ИММУНИТЕТ
  25. МИКРОБИОМ И АУТОИММУННЫЕ БОЛЕЗНИ
  26. ПРОБИОТИКИ и ГРУДНЫЕ ДЕТИ
  27. ПРОБИОТИКИ, БЕРЕМЕННОСТЬ, РОДЫ
  28. ДИСБАКТЕРИОЗ
  29. ВИТАМИННЫЙ СИНТЕЗ
  30. АМИНОКИСЛОТНЫЙ СИНТЕЗ
  31. АНТИМИКРОБНЫЕ СВОЙСТВА
  32. СИНТЕЗ ЛЕТУЧИХ ЖИРНЫХ КИСЛОТ
  33. СИНТЕЗ БАКТЕРИОЦИНОВ
  34. ФУНКЦИОНАЛЬНОЕ ПИТАНИЕ
  35. АЛИМЕНТАРНЫЕ ЗАБОЛЕВАНИЯ
  36. ПРОБИОТИКИ ДЛЯ СПОРТСМЕНОВ
  37. ПРОИЗВОДСТВО ПРОБИОТИКОВ
  38. ЗАКВАСКИ ДЛЯ ПИЩЕВОЙ ПРОМЫШЛЕННОСТИ
  39. НОВОСТИ