ДНК и гены

ДНК ПРОКАРИОТ И ЭУКАРИОТ

jzwvo9_z7ag.jpg
Крупнейшая спираль ДНК человека, выстроенная из людей на пляже в Варне (Болгария), вошедшая в книгу рекордов Гиннесса

Справа крупнейшая спираль ДНК человека, выстроенная из людей на пляже в Варне (Болгария), вошедшая в книгу рекордов Гиннесса 23 апреля 2016 года

Дезоксирибонуклеиновая кислота. Общие сведения

DNAСодержание страницы:
ДНК (дезоксирибонуклеиновая кислота) – своеобразный чертеж жизни, сложный код, в котором заключены данные о наследственной информации. Эта сложная макромолекула способна хранить и передавать наследственную генетическую информацию из поколения в поколение. ДНК определяет такие свойства любого живого организма как наследственность и изменчивость. Закодированная в ней информация задает всю программу развития любого живого организма. Генетически заложенные факторы предопределяют весь ход жизни как человека, так и любого др. организхма. Искусственное или естественное воздействие внешней среды способны лишь в незначительной степени повлиять на общую выраженность отдельных генетических признаков или сказаться на развитии запрограммированных процессов.

Дезоксирибонуклеи́новая кислота (ДНК) — макромолекула (одна из трёх основных, две другие — РНК и белки), обеспечивающая хранение, передачу из поколения в поколение и реализацию генетической программы развития и функционирования живых организмов. ДНК содержит информацию о структуре различных видов РНК и белков.

В клетках эукариот (животных, растений и грибов) ДНК находится в ядре клетки в составе хромосом, а также в некоторых клеточных органоидах (митохондриях и пластидах). В клетках прокариотических организмов (бактерий и архей) кольцевая или линейная молекула ДНК, так называемый нуклеоид, прикреплена изнутри к клеточной мембране. У них и у низших эукариот (например, дрожжей) встречаются также небольшие автономные, преимущественно кольцевые молекулы ДНК, называемые плазмидами.

С химической точки зрения ДНК — это длинная полимерная молекула, состоящая из повторяющихся блоков — нуклеотидов. Каждый нуклеотид состоит из азотистого основания, сахара (дезоксирибозы) и фосфатной группы. Связи между нуклеотидами в цепи образуются за счёт дезоксирибозы (С) и фосфатной (Ф) группы (фосфодиэфирные связи).

Каждый нуклеотид состоит из азотистого основания, сахара (дезоксирибозы) и фосфатной группы.

Рис. 2. Нуклертид состоит из азотистого основания, сахара (дезоксирибозы) и фосфатной группы

В подавляющем большинстве случаев (кроме некоторых вирусов, содержащих одноцепочечную ДНК) макромолекула ДНК состоит из двух цепей, ориентированных азотистыми основаниями друг к другу. Эта двухцепочечная молекула закручена по винтовой линии.

В ДНК встречается четыре вида азотистых оснований (аденин, гуанин, тимин и цитозин). Азотистые основания одной из цепей соединены с азотистыми основаниями другой цепи водородными связями согласно принципу комплементарности: аденин соединяется только с тимином (А-Т), гуанин — только с цитозином (Г-Ц). Именно эти пары и составляют «перекладины» винтовой "лестницы" ДНК (см.: рис. 2, 3 и 4).

Аденин - тимин, цитозин - гуанин

Рис. 2. Азотистые основания

Последовательность нуклеотидов позволяет «кодировать» информацию о различных типах РНК, наиболее важными из которых являются информационные, или матричные (мРНК), рибосомальные (рРНК) и транспортные (тРНК). Все эти типы РНК синтезируются на матрице ДНК за счёт копирования последовательности ДНК в последовательность РНК, синтезируемой в процессе транскрипции, и принимают участие в биосинтезе белков (процессе трансляции). Помимо кодирующих последовательностей, ДНК клеток содержит последовательности, выполняющие регуляторные и структурные функции.

репликация

Рис. 3. Репликация ДНК

Расположение базовых комбинаций химических соединений ДНК и количественные соотношения между этими комбинациями обеспечивают кодирование наследственной информации.

Образование новой ДНК (репликация)

  1. Процесс репликации: раскручивание двойной спирали ДНК — синтез комплементарных цепей ДНК-полимеразой — образование двух молекул ДНК из одной.
  2. Двойная спираль «расстегивается» на две ветви, когда ферменты разрушают связь между базовыми парами химических соединений.
  3. Каждая ветвь является элементом новой ДНК. Новые базовые пары соединяются в той же последовательности, что и в родительской ветви.

По завершении дупликации образуются две самостоятельные спирали, созданные из химических соединений родительской ДНК и имеющие с ней одинаковый генетический код. Таким путем ДНК способна перерывать информацию от клетки к клетке.

Более подробная информация:

СТРОЕНИЕ НУКЛЕИНОВЫХ КИСЛОТ

agct

Рис. 4 . Азотистые основания: аденин, гуанин, цитозин, тимин

Дезоксирибонуклеиновая кислота (ДНК) относится к нуклеиновым кислотам. Нуклеиновые кислоты – это класс нерегулярных биополимеров, мономерами которых являются нуклеотиды.

Нуклеотиды состоят из азотистого основания, соединенного с пятиуглеродным углеводом (пентозой) – дезоксирибозой (в случае ДНК) или рибозой (в случае РНК), который соединяется с остатком фосфорной кислоты (H2PO3–).

Азотистые основания бывают двух типов: пиримидиновые основания – урацил (только в РНК), цитозин и тимин, пуриновые основания – аденин и гуанин.

азотистые, пиримидиновые и пуриновые основания

Рис. 5. Типы азотистых оснований: пиримидиновые и пуриновые

Атомы углерода в молекуле пентозы нумеруются числами от 1 до 5. Фосфат соединяется с третьим и пятым атомами углерода. Так нуклеинотиды соединяются в цепь нуклеиновой кислоты. Таким образом, мы можем выделить 3’ и 5’-концы цепи ДНК:

нуклеинотиды соединяются в цепь нуклеиновой кислоты

Рис. 6. Выделение выделить 3’ и 5’-концов цепи ДНК

Две цепи ДНК образуют двойную спираль. Эти цепи в спирали сориентированы в противоположных направлениях. В разных цепях ДНК азотистые основания соединены между собой с помощью водородных связей. Аденин всегда соединяется с тимином, а цитозин – с гуанином. Это называется правилом комплементарности.

Правило комплементарности:

A–T G–C

Например, если нам дана цепь ДНК, имеющая последовательность

3’– ATGTCCTAGCTGCTCG – 5’,

то вторая ей цепь будет комплементарна и направлена в противоположном направлении – от 5’-конца к 3’-концу:

5’– TACAGGATCGACGAGC– 3’.

Направленность цепей молекулы ДНК и соединение азотистых оснований с помощью водородных связей

Рис. 7. Направленность цепей молекулы ДНК и соединение азотистых оснований с помощью водородных связей

РЕПЛИКАЦИЯ

Репликация ДНК – это процесс удвоения молекулы ДНК путем матричного синтеза. Репликация происходит по полуконсервативному механизму. Это значит, что двойная спираль ДНК расплетается и на каждой из ее цепей по принципу комплементарности достраивается новая цепь. Дочерняя молекула ДНК, таким образом, содержит в себе одну цепь от материнской молекулы и одну вновь синтезированную. Репликация происходит в направлении от 3’ к 5’ концу материнской цепи.

репликация ДНК

Рис. 8. Репликация (удвоение) молекулы ДНК

ДНК-синтез – это не такой сложный процесс, как может показаться на первый взгляд. Если подумать, то для начала нужно разобраться, что же такое синтез. Это процесс объединения чего-либо в одно целое. Образование новой молекулы ДНК проходит в несколько этапов:

  • ДНК-топоизомераза, располагаясь перед вилкой репликации, разрезает ДНК для того, чтобы облегчить ее расплетание и раскручивание.
  • ДНК-хеликаза вслед за топоизомеразой влияет на процесс «расплетения» спирали ДНК.
  • Связывающие ДНК-белки осуществляют связывание нитей ДНК, а также проводят их стабилизацию, не допуская их прилипания друг к другу.
  • ДНК-полимераза синтезирует ведущую цепь дочерней ДНК.

репликация ДНК

Рис. 9. Схематическое изображение процесса репликации, цифрами отмечены: (1) Запаздывающая нить, (2) Лидирующая нить, (3) ДНК-полимераза (Polα), (4) ДНК-лигаза, (5) РНК-праймер, (6) Праймаза, (7) Фрагмент Оказаки, (8) ДНК-полимераза (Polδ), (9) Хеликаза, (10) Белки, связывающие одноцепочечную ДНК, (11) Топоизомераза

Строение РНК

Рибонуклеиновая кислота (РНК) — одна из трёх основных макромолекул (две другие — ДНК и белки), которые содержатся в клетках всех живых организмов.

Так же, как ДНК, РНК состоит из длинной цепи, в которой каждое звено называется нуклеотидом. Каждый нуклеотид состоит из азотистого основания, сахара рибозы и фосфатной группы. Однако в отличие от ДНК, РНК обычно имеет не две цепи, а одну. Пентоза в РНК представлена рибозой, а не дезоксирибозой (у рибозы присутствует дополнительная гидроксильная группа на втором атоме углевода). Наконец, ДНК отличается от РНК по составу азотистых оснований: вместо тимина (Т) в РНК представлен урацил (U), который также комплементарен аденину.

Последовательность нуклеотидов позволяет РНК кодировать генетическую информацию. Все клеточные организмы используют РНК (мРНК) для программирования синтеза белков.

Клеточные РНК образуются в ходе процесса, называемого транскрипцией, то есть синтеза РНК на матрице ДНК, осуществляемого специальными ферментами — РНК-полимеразами.

Затем матричные РНК (мРНК) принимают участие в процессе, называемом трансляцией, т.е. синтеза белка на матрице мРНК при участии рибосом. Другие РНК после транскрипции подвергаются химическим модификациям, и после образования вторичной и третичной структур выполняют функции, зависящие от типа РНК.

строение РНК

Рис. 10.  Отличие ДНК от РНК по азотистому основанию: вместо тимина (Т) в РНК представлен урацил (U), который также комплементарен аденину.

ТРАНСКРИПЦИЯ

Транскрипция – это процесс синтеза РНК на матрице ДНК. ДНК раскручивается на одном из участков. На одной из цепей содержится информация, которую необходимо скопировать на молекулу РНК – эта цепь называется кодирующей. Вторая цепь ДНК, комплементарная кодирующей, называется матричной. В процессе транскрипции на матричной цепи в направлении 3’ – 5’ (по цепи ДНК) синтезируется комплементарная ей цепь РНК. Таким образом, создается РНК-копия кодирующей цепи.

Транскрипция

Рис. 11. Схематическое изображение транскрипции

Например, если нам дана последовательность кодирующей цепи

3’– ATGTCCTAGCTGCTCG – 5’,

то, по правилу комплементарности, матричная цепь будет нести последовательность

5’– TACAGGATCGACGAGC– 3’,

а синтезируемая с нее РНК – последовательность

3’– AUGUCCUAGCUGCUCG – 5’.

ТРАНСЛЯЦИЯ

Рассмотрим механизм синтеза белка на матрице РНК, а также генетический код и его свойства. Также для наглядности по ниже приведенной ссылке рекомендуем посмотреть небольшое видео о процессах транскрипции и трансляции, происходящих в живой клетке:

video.jpg
В представленном видоролике (кнопка-ссылка слева) показан процесс образования белка из аминокислот. Наглядно (в анимированном варианте) продемонстрированы процессы транскрипции и трансляции. Биосинтез белка на рибосоме также кратко описан в разделе Аминокислоты белков. Более подробное видео о геноме, ДНК и ее структуре, а также процессах кодировки представленно ниже на данной странице: Видео по теме ДНК
СИНТЕЗ БЕЛКА

Рис. 12. Процесс синтеза белка: ДНК кодирует РНК, РНК кодирует белок

ГЕНЕТИЧЕСКИЙ КОД

Генетический код - способ кодирования аминокислотной последовательности белков с помощью последовательности нуклеотидов. Каждая аминокислота кодируется последовательностью из трех нуклеотидов - кодоном или триплетом.

Генетический код, общий для большинства про- и эукариот. В таблице приведены все 64 кодона и указаны соответствующие аминокислоты. Порядок оснований — от 5' к 3' концу мРНК.

Таблица 1. Стандартный генетический код

1-е
основа
ние
2-е основание
3-е
основа
ние
U
C
A
G
U
UUU
(Phe/F)
UCU
(Ser/S)
UAU
(Tyr/Y)
UGU
(Cys/C)
U
UUC
UCC
UAC
UGC
C
UUA
(Leu/L)
UCA
UAA
Стоп-кодон**
UGA
Стоп-кодон**
A
UUG
UCG
UAG
Стоп-кодон**
UGG
(Trp/W)
G
C
CUU
CCU
(Pro/P)
CAU
(His/H)
CGU
(Arg/R)
U
CUC
CCC
CAC
CGC
C
CUA
CCA
CAA
(Gln/Q)
CGA
A
CUG
CCG
CAG
CGG
G
A
AUU
(Ile/I)
ACU
(Thr/T)
AAU
(Asn/N)
AGU
(Ser/S)
U
AUC
ACC
AAC
AGC
C
AUA
ACA
AAA
(Lys/K)
AGA
A
AUG
(Met/M)
ACG
AAG
AGG
G
G
GUU
(Val/V)
GCU
(Ala/A)
GAU
(Asp/D)
GGU
(Gly/G)
U
GUC
GCC
GAC
GGC
C
GUA
GCA
GAA
(Glu/E)
GGA
A
GUG
GCG
GAG
GGG
G

Среди триплетов есть 4 специальных последовательности, выполняющих функции «знаков препинания»:

  • *Триплет AUG, также кодирующий метионин, называется старт-кодоном. С этого кодона начинается синтез молекулы белка. Таким образом, во время синтеза белка, первой аминокислотой в последовательности всегда будет метионин.
  • **Триплеты UAA, UAG и UGA называются стоп-кодонами и не кодируют ни одной аминокислоты. На этих последовательностях синтез белка прекращается.

Свойства генетического кода

1. Триплетность. Каждая аминокислота кодируется последовательностью из трех нуклеотидов – триплетом или кодоном.

Непрерывность. Между триплетами нет никаких дополнительных нуклеотидов, информация считывается непрерывно.

2. Непрерывность. Между триплетами нет никаких дополнительных нуклеотидов, информация считывается непрерывно.

Непрерывность. Между триплетами нет никаких дополнительных нуклеотидов, информация считывается непрерывно.

3. Неперекрываемость. Один нуклеотид не может входить одновременно в два триплета.

Неперекрываемость. Один нуклеотид не может входить одновременно в два триплета.

4. Однозначность. Один кодон может кодировать только одну аминокислоту.

Однозначность. Один кодон может кодировать только одну аминокислоту.

5. Вырожденность. Одна аминокислота может кодироваться несколькими разными кодонами.

Вырожденность. Одна аминокислота может кодироваться несколькими разными кодонами.

6. Универсальность. Генетический код одинаков для всех живых организмов.

Пример. Нам дана последовательность кодирующей цепи:

3’– CCGATTGCACGTCGATCGTATA– 5’.

Матричная цепь будет иметь последовательность:

5’– GGCTAACGTGCAGCTAGCATAT– 3’.

Теперь «синтезируем» с этой цепи информационную РНК:

3’– CCGAUUGCACGUCGAUCGUAUA– 5’.

Синтез белка идет в направлении 5’ → 3’, следовательно, нам нужно перевернуть последовательность, чтобы «прочитать» генетический код:

5’– AUAUGCUAGCUGCACGUUAGCC– 3’.

Теперь найдем старт-кодон AUG:

5’– AUAUGCUAGCUGCACGUUAGCC– 3’.

Разделим последовательность на триплеты:

деление последовательности на триплеты

Найдем стоп-кодон и согласно таблице генетического кода запишем последовательность аминокислот:

Найдем стоп-кодон и согласно таблице генетического кода запишем последовательность аминокислот

Центральная догма молекулярной биологии звучит следующим образом: информация с ДНК передается на РНК (транскрипция), с РНК – на белок (трансляция). ДНК также может удваиваться путем репликации, и также возможен процесс обратной транскрипции, когда по матрице РНК синтезируется ДНК, но такой процесс в основном характерен для вирусов.

Центральная догма молекулярной биологии

Рис. 13. Центральная догма молекулярной биологии

ГЕНОМ: ГЕНЫ и ХРОМОСОМЫ

(общие понятия)

Геном - совокупность всех генов организма; его полный хромосомный набор.

Термин "геном" был предложен Г. Винклером в 1920 г. для описания совокупности генов, заключенных в гаплоидном наборе хромосом организмов одного биологического вида. Первоначальный смысл этого термина указывал на то, что понятие генома в отличие от генотипа является генетической характеристикой вида в целом, а не отдельной особи. С развитием молекулярной генетики значение данного термина изменилось. Известно, что ДНК, которая является носителем генетической информации у большинства организмов и, следовательно, составляет основу генома, включает в себя не только гены в современном смысле этого слова. Большая часть ДНК эукариотических клеток представлена некодирующими ("избыточными") последовательностями нуклеотидов, которые не заключают в себе информации о белках и нуклеиновых кислотах. Таким образом, основную часть генома любого организма составляет вся ДНК его гаплоидного набора хромосом.

Гены — это участки молекул ДНК, кодирующие полипептиды и молекулы РНК

За последнее столетие наше представление о генах существенно изменилось. Ранее геном называли участок хромосомы, кодирующий или определяющий один признак или фенотипическое (видимое) свойство, например цвет глаз.

Безымянный3
Рис. 14. Соответствие между кодирующими участками ДНК, мРНК и аминокислотной последовательностью полипептидной цепи. 

В 1940 г. Джордж Бидл и Эдвард Тейтем предложили молекулярное определение гена. Ученые обрабатывали споры гриба Neurospora crassa рентгеновским излучением и другими агентами, вызывающими изменения в последовательности ДНК (мутации), и обнаружили мутантные штаммы гриба, утратившие некоторые специфические ферменты, что в некоторых случаях приводило к нарушению целого метаболического пути. Бидл и Тейтем пришли к выводу, что ген — это участок генетического материала, который определяет или кодирует один фермент. Так появилась гипотеза «один ген — один фермент». Позднее эта концепция была расширена до определения «один ген — один полипептид», поскольку многие гены кодируют белки, не являющиеся ферментами, а полипептид может оказаться субъединицей сложного белкового комплекса.

На рис. 14 показана схема того, как триплеты нуклеотидов в ДНК определяют полипептид -  аминокислотную последовательность белка при посредничестве мРНК. Одна из цепей ДНК играет роль матрицы для синтеза мРНК, нуклеотидные триплеты (кодоны) которой комплементарны триплетам ДНК. У некоторых бактерий и многих эукариот кодирующие последовательности прерываются некодирующими участками(так называемыми интронами).

Современное биохимическое определение гена еще более конкретно. Генами называются все участки ДНК, кодирующие первичную последовательность конечных продуктов, к которым относятся полипептиды или РНК, обладающие структурной или каталитической функцией.

Наряду с генами ДНК содержит и другие последовательности, выполняющие исключительно регуляторную функцию. Регуляторные последовательности могут обозначать начало или конец генов, влиять на транскрипцию или указывать место инициации репликации или рекомбинации. Некоторые гены могут экспрессироваться разными путями, при этом один и тот же участок ДНК служит матрицей для образования разных продуктов.

Мы можем приблизительно рассчитать минимальный размер гена, кодирующего средний белок. Каждая аминокислота в полипептидной цепи кодируется последовательностью из трех нуклеотидов; последовательности этих триплетов (кодонов) соответствуют цепочке аминокислот в полипептиде, который кодируется данным геном. Полипептидная цепь из 350  аминокислотных остатков (цепь средней длины) соответствует последовательности из 1050 п.н. (пар нуклеотидов). Однако многие гены эукариот и некоторые гены прокариот прерываются сегментами ДНК, не несущими информации о белке, и поэтому оказываются значительно длиннее, чем показывает простой расчет.

Сколько генов в одной хромосоме?

Хромосомы прокариот и эукариотРис. 15. Вид хромосом в прокаритической (слева) и эукариотической клеках. Гистоны (Histones) — обширный класс ядерных белков, выполняющих две основные функции: они участвуют в упаковке нитей ДНК в ядре и в эпигенетической регуляции таких ядерных процессов, как транскрипция, репликация и репарация.

Как известно, бактериальные клетки имеют хромосому в виде нити ДНК, уложенной в компактную структуру – нуклеоид. Хромосома прокариота Escherichia coli, чей геном полностью расшифрован, представляет собой кольцевую молекулу ДНК (на самом деле, это не правильный круг, а скорее петля без начала и конца), состоящую из 4 639 675 п.н. В этой последовательности содержится примерно 4300 генов белков и еще 157 генов стабильных молекул РНК. В геноме человека примерно 3,1 млрд пар нуклеотидов, соответствующих почти 29 000 генам, расположенным на 24 разных хромосомах.

Прокариоты (Бактерии).

ДНК из лизированной клетки E. coliБактерия E. coli имеет одну двухцепочечную кольцевую молекулу ДНК. Она состоит из 4 639 675 п.н. и достигает в длину примерно 1,7 мм, что превышает длину самой клетки E. coli приблизительно в 850 раз. Помимо крупной кольцевой хромосомы в составе нуклеоида многие бактерии содержат одну или несколько маленьких кольцевых молекул ДНК, свободно располагающихся в цитозоле. Такие внехромосомные элементы называют плазмидами (рис. 16).

Большинство плазмид состоит всего из нескольких тысяч пар нуклеотидов, некоторые содержат более 10000 п. н. Они несут генетическую информацию и реплицируются с образованием дочерних плазмид, которые попадают в дочерние клетки в процессе деления родительской клетки. Плазмиды обнаружены не только в бактериях, но также в дрожжах и других грибах. Во многих случаях плазмиды не дают никаких преимуществ клеткам-хозяевам, и их единственная задача — независимое воспроизведение. Однако некоторые плазмиды несут полезные для хозяина гены. Например, содержащиеся в плазмидах гены могут придавать клеткам бактерий устойчивость к антибактериальным агентам. Плазмиды, несущие ген β-лактамазы, обеспечивают устойчивость к β-лактамным антибиотикам, таким как пенициллин и амоксициллин. Плазмиды могут переходить от клеток, устойчивых к антибиотикам, к другим клеткам того же или другого вида бактерий, в результате чего эти клетки также становятся резистентными. Интенсивное применение антибиотиков является мощным селективным фактором, способствующим распространению плазмид, кодирующих устойчивость к антибиотикам (а также транспозонов, которые кодируют аналогичные гены) среди болезнетворных бактерий, и приводит к появлению бактериальных штаммов с устойчивостью к нескольким антибиотикам. Врачи начинают понимать опасность широкого использования антибиотиков и назначают их только в случае острой необходимости. По аналогичным причинам ограничивается широкое использование антибиотиков для лечения сельскохозяйственных животных.

См. также: Равин Н.В., Шестаков С.В. Геном прокариот // Вавиловский журнал генетики и селекции, 2013. Т. 17. № 4/2. С. 972–984.

Эукариоты.

Таблица 2. ДНК, гены и хромосомы некоторых организмов

Общая ДНК,
п.н.
Число хромосом*
Примерное число генов
Escherichia coli (бактерия)
4 639 675
1
4 435
Saccharomyces cerevisiae (дрожжи)
12 080 000
16**
5 860
Caenorhabditis elegans (нематода)
90 269 800
12***
23 000
Arabidopsis thaliana (растение)
119 186 200
10
33 000
Drosophila melanogaster (плодовая мушка)
120 367 260
18
20 000
Oryza sativa (рис)
480 000 000
24
57 000
Mus musculus (мышь)
2 634 266 500
40
27 000
Homo sapiens (человек)
3 070 128 600
46
29 000

Примечание. Информация постоянно обновляется; для получения более свежей информации обратитесь к сайтам, посвященным отдельным геномным проектам

*Для всех эукариот, кроме дрожжей, приводится диплоидный набор хромосом. Диплоидный набор хромосом (от греч. diploos- двойной и eidos- вид) – двойной набор хромосом (2n), каждая из которых имеет себе гомологичную.
**Гаплоидный набор. Дикие штаммы дрожжей обычно имеют восемь (октаплоидный) или больше наборов таких хромосом.
***Для самок с двумя Х хромосомами. У самцов есть Х хромосома, но нет Y, т. е. всего 11 хромосом.

В клетке дрожжей, одних из самых маленьких эукариот, в 2,6 раза больше ДНК, чем в клетке E. coli (табл. 2). Клетки плодовой мушки Drosophila, классического объекта генетических исследований, содержат в 35 раз больше ДНК, а клетки человека — примерно в 700 раз больше ДНК, чем клетки E. coli. Многие растения и амфибии содержат еще больше ДНК. Генетический материал клеток эукариот организован в виде хромосом. Диплоидный набор хромосом (2n) зависит от вида организма (табл. 2).

Например, в соматической клетке человека 46 хромосом (рис. 17). Каждая хромосома эукариотической клетки, как показано на рис. 17, а, содержит одну очень крупную двухспиральную молекулу ДНК. Двадцать четыре хромосомы человека (22 парные хромосомы и две половые хромосомы X и Y)  различаются по длине более чем в 25 раз. Каждая хромосома эукариот содержит определенный набор генов.

хромосомы человека

Рис. 17. Хромосомы эукариот. а — пара связанных и конденсированных сестринских хроматид из хромосомы человека. В такой форме эукариотические хромосомы пребывают после репликации и в метафазе в процессе митоза. б — полный набор хромосом из лейкоцита одного из авторов книги. В каждой нормальной соматической клетке человека содержится 46 хромосом.

Если соединить между собой молекулы ДНК человеческого генома (22 хромосомы и хромосомы X и Y или Х и Х), получится последовательность длиной около одного метра. Прим.: У всех млекопитающих и других организмов с гетерогаметным мужским полом, у самок две X-хромосомы (XX), а у самцов — одна X-хромосома и одна Y-хромосома (XY).

Большинство клеток человека диплоидны, поэтому общая длина ДНК таких клеток около 2м. У взрослого человека примерно 1014 клеток, таким образом, общая длина всех молекул ДНК составляет 2・1011 км. Для сравнения, окружность Земли — 4・104 км, а расстояние от Земли до Солнца — 1,5・108 км. Вот как удивительно компактно упакована ДНК в наших клетках!

В клетках эукариот есть и другие органеллы, содержащие ДНК, — это митохондрии и хлоропласты. Выдвигалось множество гипотез относительно происхождения ДНК митохондрий и хлоропластов. Общепризнанная сегодня точка зрения заключается в том, что они представляют собой рудименты хромосом древних бактерий, которые проникли в цитоплазму хозяйских клеток и стали предшественниками этих органелл. Митохондриальная ДНК кодирует митохондриальные тРНК и рРНК, а также несколько митохондриальных белков. Более 95% митохондриальных белков кодируется ядерной ДНК.

СТРОЕНИЕ ГЕНОВ

Рассмотрим строение гена у прокариот и эукариот, их сходства и различия. Несмотря на то, что ген — это участок ДНК, кодирующий всего один белок или РНК, кроме непосредственно кодирующей части, он также включает в себя регуляторные и иные структурные элементы, имеющие разное строение у прокариот и эукариот.

Кодирующая последовательность – основная структурно-функциональная единица гена, именно в ней находятся триплеты нуклеотидов, кодирующие аминокислотную последовательность. Она начинается со старт-кодона и заканчивается стоп-кодоном.

До и после кодирующей последовательности находятся нетранслируемые 5’- и 3’-последовательности. Они выполняют регуляторные и вспомогательные функции, например, обеспечивают посадку рибосомы на и-РНК.

Нетранслируемые и кодирующая последовательности составлют единицу транскрипции – транскрибируемый участок ДНК, то есть участок ДНК, с которого происходит синтез и-РНК.

Терминатор – нетранскрибируемый участок ДНК в конце гена, на котором останавливается синтез РНК.

В начале гена находится регуляторная область, включающая в себя промотор и оператор.

Промотор – последовательность, с которой связывается полимераза в процессе инициации транскрипции. Оператор – это область, с которой могут связываться специальные белки – репрессоры, которые могут уменьшать активность синтеза РНК с этого гена – иначе говоря, уменьшать его экспрессию.

Строение генов у прокариот

Общий план строения генов у прокариот и эукариот не отличается – и те, и другие содержат регуляторную область с промотором и оператором, единицу транскрипции с кодирующей и нетранслируемыми последовательностями и терминатор. Однако организация генов у прокариот и эукариот отличается.

Рис. 18. Схема строения гена у прокариот (бактерий) - изображение увеличивается

В начале и в конце оперона есть единые регуляторные области для нескольких структурных генов. С транскрибируемого участка оперона считывается одна молекула и-РНК, которая содержит несколько кодирующих последовательностей, в каждой из которых есть свой старт- и стоп-кодон. С каждого из таких участков синтезируется один белок. Таким образом, с одной молекулы и-РНК синтезируется несколько молекул белка.

Для прокариот характерно объединение нескольких генов в единую функциональную единицу – оперон. Работу оперона могут регулировать другие гены, которые могут быть заметно удалены от самого оперона – регуляторы. Белок, транслируемый с этого гена называется репрессор. Он связывается с оператором оперона, регулируя экспрессию сразу всех генов, в нем содержащихся.

Для прокариот также характерно явление сопряжения транскрипции и трансляции.

Рис. 19 Явление сопряжения транскрипции и трансляции у прокариот - изображение увеличивается

Такое сопряжение не встречается у эукариот из-за наличия у них ядерной оболочки, отделяющей цитоплазму, где происходит трансляция, от генетического материала, на котором происходит транскрипция. У прокариот во время синтеза РНК на матрице ДНК с синтезируемой молекулой РНК может сразу связываться рибосома. Таким образом, трансляция начинается еще до завершения транскрипции. Более того, с одной молекулой РНК может одновременно связываться несколько рибосом, синтезируя сразу несколько молекул одного белка.

Строение генов у эукариот

Гены и хромосомы эукариот очень сложно организованы

У бактерий многих видов всего одна хромосома, и почти во всех случаях в каждой хромосоме присутствует по одной копии каждого гена. Лишь  немногие гены, например гены рРНК, содержатся в нескольких копиях. Гены и регуляторные последовательности составляют практически весь геном прокариот. Более того, почти каждый ген строго соответствует аминокислотной последовательности (или последовательности РНК), которую он кодирует (рис. 14).

Структурная и функциональная организация генов эукариот гораздо сложнее. Исследование хромосом эукариот, а позднее секвенирование полных последовательностей геномов эукариот принесло много сюрпризов. Многие, если не большинство, генов эукариот обладают интересной особенностью: их нуклеотидные последовательности содержат один или несколько участков ДНК, в которых не кодируется аминокислотная последовательность полипептидного продукта. Такие нетранслируемые вставки нарушают прямое соответствие между нуклеотидной последовательностью гена и аминокислотной последовательностью кодируемого полипептида. Эти нетранслируемые сегменты в составе генов называют интронами, или встроенными последовательностями, а кодирующие сегменты — экзонами. У прокариот лишь немногие гены содержат интроны.

Итак, у эукариот практически не встречается объединение генов в опероны, и кодирующая последовательность гена эукариот чаще всего разделена на транслируемые участки – экзоны, и нетранслируемые участки – интроны.

В большинстве случаев функция интронов не установлена. В целом, лишь около 1,5% ДНК человека являются ≪кодирующими≫, т. е. несут информацию о белках или РНК. Однако с учетом крупных интронов получается, что ДНК человека на 30% состоит из генов. Поскольку гены составляют относительно небольшую долю в геноме человека, значительная часть ДНК остается неучтенной.

Схема строение гена у эукариот

Рис. 16. Схема строение гена у эукариот - изображение увеличивается

С каждого гена сначала синтезируется незрелая, или пре-РНК, которая содержит в себе как интроны, так и экзоны.

После этого проходит процесс сплайсинга, в результате которого интронные участки вырезаются, и образуется зрелая иРНК, с которой может быть синтезирован белок.

процесс альтернативного сплайсинга

Рис. 20. Процесс альтернативного сплайсинга - изображение увеличивается

Такая организация генов позволяет, например, осуществить процесс альтернативного сплайсинга, когда с одного гена могут быть синтезированы разные формы белка, за счет того, что в процессе сплайсинга экзоны могут сшиваться в разных последовательностях.

Сравнение строения генов прокариот и эукариот

Сравнение строения генов прокариот и эукариот

Рис. 21. Отличия в строении генов прокариот и эукариот - изображение увеличивается

МУТАЦИИ И МУТАГЕНЕЗ

Мутацией называется стойкое изменение генотипа, то есть изменение нуклеотидной последовательности.

Процесс, который приводит к возникновению мутаций называется мутагенезом, а организм, все клетки которого несут одну и ту же мутацию — мутантом.

Мутационная теория была впервые сформулирована Гуго де Фризом в 1903 году. Современный ее вариант включает в себя следующие положения:

1. Мутации возникают внезапно, скачкообразно.

2. Мутации передаются из поколения в поколение.

3. Мутации могут быть полезными, вредными или нейтральными, доминантными или рецессивными.

4. Вероятность обнаружения мутаций зависит от числа исследованных особей.

5. Сходные мутации могут возникать повторно.

6. Мутации не направленны.

Мутации могут возникать под действием различных факторов. Различают мутации, возникшие под действием мутагенных воздействий: физических (например, ультрафиолета или радиации), химических (например, колхицина или активных форм кислорода) и биологических (например, вирусов). Также мутации могут быть вызваны ошибками репликации.

В зависимости от условий появления мутации подразделяют на спонтанные — то есть мутации, возникшие в нормальных условиях, и индуцированые — то есть мутации, которые возникли при особых условиях.

Мутации могут возникать не только в ядерной ДНК, но и, например, в ДНК митохондрий или пластид. Соответственно, мы можем выделять ядерные и цитоплазматические мутации.

В результате возникновения мутаций часто могут появляться новые аллели. Если мутантный аллель подавляет действие нормального, мутация называется доминантной. Если нормальный аллель подавляет мутантный, такая мутация называется рецессивной. Большинство мутаций, приводящих к возникновению новых аллелей являются рецессивными.

По эффекту выделяют мутации адаптивные, приводящие к повышению приспособленности организма к среде, нейтральные, не влияющие на выживаемость, вредные, понижающие приспособленность организмов к условиям среды и летальные, приводящие к смерти организма на ранних стадиях развития.

По последствиям выделяются мутации, приводящие к потери функции белка, мутации, приводящие к возникновению у белка новой функции, а также мутации, которые изменяют дозу гена, и, соответственно, дозу белка синтезируемого с него.

Мутация может возникнуть к любой клетке организма. Если мутация возникает в половой клетке, она называется герминативной (герминальной, или генеративной). Такие мутации не проявляются у того организма, у которого они появились, но приводят к появлению мутантов в потомстве и передаются по наследству, поэтому они важны для генетики и эволюции. Если мутация возникает в любой другой клетке, она называется соматической. Такая мутация может в той или иной степени проявляться у того организма, у которого она возникла, например, приводить к образованию раковых опухолей. Однако такая мутация не передается по наследству и не влияет на потомков.

Мутации могут затрагивать разные по размеру участки генома. Выделяют генные, хромосомные и геномные мутации.

Генные мутации

Мутации, которые возникают в масштабе меньшем, чем один ген, называются генными, или точечными (точковыми). Такие мутации приводят к изменению одного и нескольких нуклеотидов в последовательности. Среди генных мутаций выделяют замены, приводящие к замене одного нуклеотида на другой, делеции, приводящие к выпадению одного из нуклеотидов, инсерции, приводящие к добавлению лишнего нуклеотида в последовательность.

Генные мутации: замены, делеции, инсерции

Рис. 23. Генные (точечные) мутации

По механизму воздействия на белок, генные мутации делят на: синонимичные, которые (в результате вырожденности генетического кода) не приводят к изменению аминокислотного состава белкового продукта, миссенс-мутации, которые приводят к замене одной аминокислоты на другую и могут влиять на структуру синтезируемого белка, хотя часто они оказываются незначительными, нонсенс-мутации, приводящие к замене кодирующего кодона на стоп-кодон, мутации, приводящие к нарушению сплайсинга:

синонимичные, миссенс-мутации и нонсенс-мутации

Рис. 24. Схемы мутаций

Также по механизму воздействия на белок выделяют мутации, приводящие к сдвигу рамки считывания, например, инсерции и делеции. Такие мутации, как и нонсенс-мутации, хоть и возникают в одной точке гена, часто воздействуют на всю структуру белка, что может привести к полному изменению его структуры.мутации сдвига рамки считывания

Рис. 25. Схема мутации, приводящей к сдвигу рамки считывания

Хромосомные мутации

khromosomnyye_aberratsii
Рис. 26. Хромосомные абберации

Хромосомными мутациями называются мутации, которые затрагивают отдельные гены в рамках одной хромосомы. Различают делеции, когда теряется один или несколько генов, дупликации, когда удваивается тот или иной ген или несколько генов, инверсии, когда участок хромосомы поворачивается на 180 градусов, транслокации, когда гены переходят с одной хромосомы на другую. 

Хромосомные мутации - делеции, дупликации, инверсии.  

Рис. 27. Схемы хромосомных мутаций: делеции, дупликации, инверсии

транслокация - гены переходят с одной хромосомы на другую
дупликация
Рис. 28. Транслокация
Рис. 29. Хромосома до и после дупликации

Геномные мутации

Наконец, геномные мутации затрагивают весь геном целиком, то есть меняется количество хромосом. Выделяют полиплоидии — увеличение плоидности клетки, и анеуплоидии, то есть изменение количества хромосом, например, трисомии (наличие у одной из хромосом дополнительного гомолога) и моносомии (отсутствие у хромосомы гомолога).

Видео по теме ДНК

СИНТЕЗ БЕЛКА ИЗ АМИНОКИСЛОТ ИЛИ ПОСТУЛАТ МОЛЕКУЛЯРНОЙ БИОЛОГИИ: ДНК КОДИРУЕТ РНК, РНК КОДИРУЕТ БЕЛОК

К РАЗДЕЛУ: АНТИМУТАГЕННЫЕ СВОЙСТВА

Будьте здоровы!

 

ССЫЛКИ К РАЗДЕЛУ О ПРЕПАРАТАХ ПРОБИОТИКАХ

  1. ПРОБИОТИКИ
  2. ДОМАШНИЕ ЗАКВАСКИ
  3. БИФИКАРДИО
  4. КОНЦЕНТРАТ БИФИДОБАКТЕРИЙ ЖИДКИЙ
  5. ПРОПИОНИКС
  6. ЙОДПРОПИОНИКС
  7. СЕЛЕНПРОПИОНИКС
  8. БИФИДОБАКТЕРИИ
  9. ПРОПИОНОВОКИСЛЫЕ БАКТЕРИИ
  10. ПРОБИОТИКИ И ПРЕБИОТИКИ
  11. СИНБИОТИКИ
  12. АНТИОКСИДАНТНЫЕ ФЕРМЕНТЫ
  13. АНТИОКСИДАНТНЫЕ СВОЙСТВА
  14. АНТИМУТАГЕННАЯ АКТИВНОСТЬ
  15. МИКРОФЛОРА КИШЕЧНОГО ТРАКТА
  16. МИКРОФЛОРА И ФУНКЦИИ МОЗГА
  17. ПРОБИОТИКИ И ХОЛЕСТЕРИН
  18. ПРОБИОТИКИ ПРОТИВ ОЖИРЕНИЯ
  19. МИКРОФЛОРА И САХАРНЫЙ ДИАБЕТ
  20. ПРОБИОТИКИ и ИММУНИТЕТ
  21. ПРОБИОТИКИ и ГРУДНЫЕ ДЕТИ
  22. ДИСБАКТЕРИОЗ
  23. МИКРОЭЛЕМЕНТНЫЙ СОСТАВ
  24. ПРОБИОТИКИ С ПНЖК
  25. ВИТАМИННЫЙ СИНТЕЗ
  26. АМИНОКИСЛОТНЫЙ СИНТЕЗ
  27. СИНТЕЗ ЛЕТУЧИХ ЖИРНЫХ КИСЛОТ
  28. ФУНКЦИОНАЛЬНОЕ ПИТАНИЕ
  29. АЛИМЕНТАРНЫЕ ЗАБОЛЕВАНИЯ
  30. ПРОБИОТИКИ ДЛЯ СПОРТСМЕНОВ
  31. ПРОИЗВОДСТВО ПРОБИОТИКОВ
  32. ЗАКВАСКИ ДЛЯ ПИЩЕВОЙ ПРОМЫШЛЕННОСТИ
  33. НОВОСТИ