Главная \ Метагеномный анализ кишечной микробиоты \ Метагеномный анализ микробиоты двенадцатиперстной кишки при ожирении и СД2

Метагеномное секвенирование кишечной микробиоты при ожирении и СД 2-го типа

МЕТАГЕНОМНЫЙ АНАЛИЗ ОБРАЗЦОВ МИКРОБИОТЫ ДУОДЕНАЛЬНОГО СОДЕРЖИМОГО ПАЦИЕНТОВ С ОЖИРЕНИЕМ И СД2

  метагеномный анализ микробиоты двенадцатиперстной кишки

Метагеномный анализ микробиоты двенадцатиперстной кишки выявил потенциальный биомаркер дисбактериоза при ожирении и сахарном диабете 2 типа: экспериментальное исследование

liniya.png

Tomasz Gosiewski et al.
Metagenomic Analysis of Duodenal Microbiota Reveals a Potential Biomarker of Dysbiosis in the Course of Obesity and Type 2 Diabetes: A Pilot Study
J. Clin. Med. 2020, 9, 369 

Резюме: многочисленные научные исследования подтверждают, что, помимо экологических и генетических факторов, значительную роль в этиологии сахарного диабета 2 типа и ожирения играет микробиота желудочно-кишечного тракта. В настоящее время ученые уделяют основное внимание микробиоте дистального отдела кишечника, в то время как не менее важные проксимальные отделы кишечника остаются без внимания. Целью исследования явился качественный анализ структуры микробиоты слизистой оболочки двенадцатиперстной кишки в группах больных с ожирением и сахарным диабетом 2 типа и где ожирение квалифицировалось для проведения бариатрической операции: рукавной гастрэктомии. Полученные микробиологические результаты сравнивали с некоторыми клиническими показателями. В результате удалось определить микробиологическое ядро, которое было общим для лечебной и контрольной групп, включая типы: Firmicutes, Proteobacteria и Actinobacteria. У пациентов с ожирением и сахарным диабетом 2 типа и ожирением было выявлено значительно меньшее количество представителей рода Bifidobacterium по сравнению со здоровыми лицами. Кроме того, количество бифидобактерий положительно коррелировало с концентрацией липопротеидов высокой плотности (ЛПВП) в исследуемых группах. Полученные результаты свидетельствуют о том, что бактерии рода Bifidobacterium следует рассматривать в будущем в контексте потенциального биомаркера в прогрессировании сахарного диабета 2 типа и ожирения.

1. Вступление

Число пациентов с ожирением и сахарным диабетом 2-го типа (СД 2 типа) растет тревожными темпами как в развитых, так и в развивающихся странах. Всемирная организация здравоохранения (ВОЗ) признала диабет и ожирение первой неинфекционной эпидемией. По данным ВОЗ от 07.04.2016 г., более 422 млн человек в мире имеют сахарный диабет и каждый десятый человек страдает ожирением [1]. Вызывает также беспокойство тот факт, что проблема диабета и ожирения все чаще затрагивает подростков. Несмотря на значительный прогресс в медицине, эффективных средств борьбы с этими заболеваниями не найдено, и прогнозы на последующие годы прогнозируют, что к 2040 году число людей с сахарным диабетом в мире превысит 642 миллиона [2].

При изучении взаимосвязи между микробиотой и ожирением, сахарным диабетом 2 типа или другими метаболическими заболеваниями основным инструментом исследования является секвенирование следующего поколения, где исходный материал, подвергнутый соответствующей обработке и метагеномному анализу, состоит из бактериальных ДНК-изолятов из образцов фекалий пациентов. Поэтому микробиота толстого кишечника достаточно хорошо описана [3]. Некоторые исследования, однако, предлагают другой подход, который предполагает, что этот тип исследований должен быть сосредоточен в первую очередь на микробиоте тонкого кишечника [3,4]. В литературе микробиологический анализ верхних отделов пищеварительного тракта, например двенадцатиперстной кишки, особенно при прогрессировании ожирения или сахарного диабета, редко является предметом обсуждения [3,4].

Основной причиной отсутствия работ на эту тему является трудность доступа к проксимальным отделам кишечника [4], так как сбор биопсии связан с инвазивным вмешательством, которое требует использования гастроскопа. Другими причинами являются кислотный рН желудка и наличие пищеварительных ферментов, обитающих в тонком кишечнике, которые значительно уменьшают количество микробных клеток [5]. Большинство литературных данных, основанных на исследованиях микробиоты двенадцатиперстной кишки, которые можно найти, в основном касаются педиатрических пациентов с целиакией [6-8].

Дуоденальный отдел желудочно-кишечного тракта расположен на пересечении между желудком, выделяющим пищеварительные ферменты, и тощей кишкой и подвздошной кишкой, которые поглощают питательные вещества. Благодаря своему стратегическому положению в желудочно-кишечном тракте, двенадцатиперстная кишка выполняет важные функции, связанные с пищеварительным процессом и всасыванием питательных веществ [9]. Поэтому структура микробиоты в пределах этого раздела заслуживает изучения.

Цель настоящего исследования - охарактеризовать структуру микробиоты слизистой оболочки двенадцатиперстной кишки у пациентов с ожирением, а также с сахарным диабетом 2 типа и ожирением, прошедших бариатрическую хирургию ‐ рукавную резекцию желудка.

2. Опытный участок

2.1. Пациенты

В исследование были включены 66 пациентов 2–го отделения общей хирургии Медицинского колледжа Ягеллонского университета (17 с ожирением, 22 с сахарным диабетом 2 типа и ожирением и 27 здоровых пациентов с нормальной массой тела (ИМТ 18,5-24,9 кг/м2), которые вошли в программу скрининга рака желудка. Критериями включения в группу пациентов с ожирением и сахарным диабетом 2 типа (СД 2 типа) и ожирением были: пациенты с клиническим диагнозом ожирение/сахарный диабет в возрасте от 20 до 70 лет, прием пероральных препаратов в течение не менее 2 лет после постановки диагноза (только для СД 2 типа), длительность заболевания не менее 2 лет, ИМТ >35 кг/м2. Критериями исключения были: возраст до 20 и старше 70 лет, антибактериальная терапия в течение 30 дней до взятия биопсии двенадцатиперстной кишки, применение пробиотической терапии в течение 30 дней до взятия биопсии двенадцатиперстной кишки, подтвержденные желудочно-кишечные инфекции, хронические воспалительные заболевания кишечника, врожденные и приобретенные иммунодефициты, алкогольная или наркотическая зависимость, состояния, требующие психиатрического лечения, беременные женщины, пациенты с LADA (латентный аутоиммунный диабет взрослых) или MODY (Диабет начала зрелости молодежи), а также отсутствие согласия на участие в исследовании или отзыв согласия во время исследования.

Этические Соображения:

Все испытуемые дали свое информированное согласие на включение в исследование до того, как они приняли в нем участие. Исследование проводилось в соответствии с Хельсинкской декларацией и протоколом, одобренным Комитетом по биоэтике Ягеллонского университета (No. KBET / 47 / B / 2009).

2.2. Образцы

Исследуемым материалом служили биоптаты из нисходящей части двенадцатиперстной кишки, полученные с помощью гастроскопа. Пациентам проводилось рутинное лабораторное обследование, включавшее определение уровня глюкозы крови натощак, гликозилированного гемоглобина (HbA1c), общего холестерина, липопротеидов низкой плотности (ЛПНП), липопротеидов высокой плотности (ЛПВП), триглицеридов (ТГ) и аланинаминотрансферазы (АЛТ). Полученные биологические материалы, выдержанные в условиях глубокой заморозки, вместе с результатами анализов и подписанными пациентами бланками согласия на участие в исследовании были доставлены в лабораторию департамента молекулярной медицинской микробиологии (кафедра микробиологии медицинского колледжа Ягеллонского университета).

Бактериальную ДНК выделяли из 66 образцов биопсии двенадцатиперстной кишки и 5 образцов стерильной воды (включенных в исследование в качестве отрицательного контроля) с использованием набора Mini Genomic (A & A Biotechnology, Гданьск, Польша) в соответствии с методом, разработанным Gosiewski et al. [10]. Концентрацию и чистоту общих изолятов ДНК измеряли с использованием спектрофотометра NanoDrop (Thermo Scientific).

Из-за физиологически небольшого количества бактерий, колонизирующих двенадцатиперстную кишку, было необходимо использовать метод гнездовой ПЦР, который позволил повысить чувствительность и специфичность изолятов, амплифицированных для секвенирования. Праймеры, нацеленные на области V3 и V4 гена 16S рРНК, состав реакционной смеси и программа амплификации представлены в таблице 1.

Таблица 1. Последовательности праймеров, реакционной смеси и программы амплификации, использованные в исследовании.

Олигонуклеотидная последовательность (5`-> 3`)
Реакционная смесь
Программа амплификации
F: ACGGCCNNRACTCCTAC 1
Вода
2.6μl
95 ⁰C–5 min
R: TTACGGNNTGGACTACHV
Kappa (каппа-полимераза – ред.)
5.0μl
95 ⁰C–15 sec
48 ⁰C–20 sec
72 ⁰C–30 sec
}
40x
Праймер F (10μM)
0.2μl
Праймер R (10μM)
0.2μl
ДНК
2.0μl
72 ⁰C–5 min
 
F: CCTACGGGNGGCWGCAG 2
Вода
10.5μl
95 ⁰C–5 min
R: GACTACHVGGGTATCTAATCC
Kappa (каппа-полимераза – ред.)
12.5μl
95 ⁰C–30 sec
55 ⁰C–30 sec
72 ⁰C–30 sec
}
25x
Праймер F (10μM)
0.5μl
Праймер R (10μM)
0.5μl
ДНК
1.0μl
72 ⁰C–5 min

Выступающие последовательности адаптера   (F:TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG и R:  GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG) были добавлены к внутреннему праймеру, прикрепленному к концу 5'. 1Внутренние праймеры, 2внешние праймеры.


Продукты амплификации подвергали электрофорезу для проверки размеров ампликона. Дальнейшие этапы были подготовлены в соответствии с протоколом для секвенсора MiSeq (Illumina).

Микробиологические данные, полученные на каждом таксономическом уровне, коррелировали с клиническими показателями пациентов (общий холестерин, ЛПНП, ЛПВП, ТГ, АЛТ и HbA1c), а также возрастом и ИМТ.

2.3. Биоинформатический анализ

Первый этап анализа биоинформатики включал в себя объединение парных чтений и анализ качества. Объединенные чтения со средним качеством Q <15 (phred +33 показателя качества) были удалены из дальнейшего анализа. Затем была выполнена дедупликация и кластеризация в оперативные таксономические единицы (OTUs). Последовательности были сгруппированы с 97%-ным порогом идентичности. Созданные OTUs затем были аннотированы в соответствии с пользовательской базой данных последовательности 16S. Пользовательская база данных (BioMeta16SRef, v1.1.6) содержит 19316 бактериальных и археальных последовательностей 16S, полученных из базы данных Greengenes и NCBI (Национальный центр биотехнологической информации) 10 сентября 2018 года. Аннотация последовательности OTU была выполнена с использованием программного обеспечения QIIME (сценарии assign_taxonomy.py и sumrize_taxa.py) [11]. Аннотированные показания, полученные от отрицательных контролей (пробы воды, n = 5), были удалены из диагностических проб и из дальнейшего анализа. На следующем этапе последовательности OTU были выровнены с эталонными последовательностями гена 16S (BioMeta16SALN, v1.1.6), содержащими выровненные эталонные последовательности 16S) с использованием align_seq.py script и алгоритма PyNAST (QIIME) (PyNAST: Python-инструмент для завершения ближайшего выравнивания – ред.)

2.4. Статистический анализ

Характеристики пациента: для выбора подходящего статистического теста был проведен тест Шапиро-Уилка для оценки наличия или отсутствия нормального распределения. Только данные по параметру концентрации ЛПНП соответствовали условиям теста, поэтому был проведен тест ANOVA с выявлением различий между группами методом Post hoc анализа Tukey. Для анализа остальных данных использовался непараметрический тест Крускала–Уоллиса с Post hoc анализом (тест Nemeny).

Альфа-анализ биоразнообразия между частотами OTUs был выполнен с использованием конвейера alpha_rarefaction.py, реализованного в пакете QIIME. Статистические данные были рассчитаны с использованием сценария compare_alpha_diversity.py (QIIME) для каждого индекса биоразнообразия. Статистический анализ проводился с помощью двух тестов: t-параметрического и t‐непараметрического (Монте‐Карло).

Бета-анализ биоразнообразия между частотами OTUs был выполнен с использованием конвейера beta_diversity.py, реализованного в пакете QIIME. Максимальное число считываний для анализа определялось как отношение 85% от числа считываний, представляющих наименьшую выборку (36TK: 8,142; 0.85 × 8142 = 6921). Статистический анализ проводился на основе двустороннего t‐критерия Стьюдента. Непараметрические p-значения были рассчитаны с помощью 999 перестановок Монте-Карло.

Анализ OTUs, отнесенных к соответствующим таксономическим уровням в пределах двух групп лечения и контрольной группы, проводили с использованием сценария summarize_taxa.py, реализованного в программном пакете QIIME. Статистический анализ проводился с помощью сценария group_significance.py (QIIME). Для каждого таксономического уровня были проведены два типа статистических тестов ANOVA и теста Крускала–Уоллиса. Сравнительный анализ проводился в следующих подгруппах: СД2 и контроль, СД2 и ожирение, а также ожирение и контроль. Для этого использовался непараметрический t-критерий (Монте-Карло, 999 перестановок).

Корреляционный анализ микробиологических и клинических данных: разделение на отдельные таксономические уровни проводилось с использованием сценария (скрипта) summarize_taxa.py, реализованного в пакете QIIME. Статистический корреляционный анализ клинических данных проводился с использованием сценария observation_metadata _correlation.py (QIIME). Для каждого таксономического уровня были проведены корреляции двух типов: Пирсона и Спирмена. Значение вероятности оценивалось на основе Z-распределения Фишера. Значимыми статистическими результатами были те, чье значение вероятности после коррекции FDR (коэффициента ложного обнаружения) было меньше 0,05.

3. Результаты

3.1. Характеристика исследуемой популяции

Клинические данные пациентов из лечебной и контрольной групп представлены в таблице 2. Статистически значимых различий между группами по двум параметрам - возрасту и концентрации ЛПНП - не наблюдалось.

Для облегчения анализа представленных результатов были использованы следующие названия групп: СД2-группа – группа больных сахарным диабетом 2 типа и ожирением, ожирение - группа больных ожирением без сахарного диабета, контроль - группа здоровых пациентов.

Таблица 2. Сравнительная характеристика клинических данных в группе лечения и контрольной группе.

Параметр
Контроль (n=27)
Ожирение (n=17)
СД2 (n=22)
р-значение
Возраст [лет]
42 (36.0–48.5)
40 (26–42)
45.5 (37.0–55.25)
p = 0.179
ИМТ [kg/m2]
23.2 (22.9–23.7)
45 (42.2–5.2)
44 (40.1–47.1)
p < 0.001
HbA1c [%]
5.2 (5.1–5.3)
5.3 (5.2–5.5)
6.25 (6.1–6.5)
p < 0.001
Общий холестерин [ммоль / л]
5.1 (4.9–5.2)
4.5 (3.6–5.0)
3.9 (3.4–5.4)
p = 0.003
ЛПВП [ммоль / л]
0.98 (0.91–3.0)
1.14 (1.13–1.23)
1 (0.7–1.18)
p = 0.040
ЛПНП [ммоль / л]
3.16 (0.88)
2.75 (0.65)
2.73 (0.98)
p = 0.160
ТГ [ммоль / л]
0.9 (0.9–1.2)
1.26 (0.9–1.7)
1.6 (1.5–1.9)
p = 0.005
АЛТ [Ед/л]
20 (18.0–25.6)
44 (28–91)
47 (22.0–178.5)
p < 0.001

Данные представлены в виде медианы (межквартильный диапазон), за исключением концентрации ЛПНП (средняя). Значение р менее 0,05 считалось значимым. Сокращения: СД2 (диабет 2 типа), ИМТ (индекс массы тела), HbA1c (гликированный гемоглобин), ЛПВП (липопротеин высокой плотности), ЛПНП (липопротеин низкой плотности), ТГ (триглицериды), АЛТ (аланинаминотрансфераза).

3.2. Метагеномное секвенирование

После секвенирования 66 диагностических образцов было получено 9536638 считываний гена 16S рРНК. Количество парных чтений составило 8606568 (90,25%). Средние размеры чтений составляли 74540.2 на образец (минимальное количество чтений на образец составляло 8142, максимальное 206703 и медиана 63860.5). Филогенетическая сводка результатов представлена в таблице 3.

Таблица 3. Филогенетическая сводка полученных результатов.

таксономический уровень
изобилие 1
количество чтений
% прочтений 2
царство
1
4,844,701
98.50%
тип
7
4,844,701
98.50%
класс
22
4,844,701
98.50%
порядок
43
4,844,701
98.50%
семья
100
4,840,921
98.40%
род
175
4,720,767
95.96%
вид
149
1,948,899
39.61%

В таблицу не включены другие таксономии, которые указывают на неоднозначный результат выравнивания. 1начисление различных таксонов, отнесенных к систематическому уровню. 2перенос чтений, отнесенных к соответствующим систематическим уровням.


Настоящие результаты были получены с использованием программного обеспечения Bioidea под названием BioMeta16S (https://bioidea.com.pl/en, v1.1.0). Разработанная компанией Bioidea база данных последовательностей BioMeta16SRef (v1.1.6) была создана на основе данных из многих источников, в первую очередь баз данных Greengenes и NCBI. Периодические и автоматические обновления базы данных BioMeta16SRef обеспечивают непрерывное обогащение новыми микробными последовательностями. Пакет BioMeta16S позволил идентифицировать бактерии с точностью 98,50% до уровня порядка и 95,96% до уровня рода, как показано в таблице 3.

На уровне видов эта величина была намного ниже, то есть 39,61%, из-за многих последовательностей, которые показали высокий (на 97%), но тот же процент подобия. Эта проблема неизбежна при секвенировании коротких фрагментов. Здесь обычно автоматически выбирается первый результат, который не всегда отражает правильную процедуру. По этой причине в анализ уровня L7 были включены только OTUs, которые были явно отнесены к определенному виду.

Альфа-разнообразие, выраженное в индексе Chao1 (оценке, основанной на изобилии, показывающей, как требуемые данные относятся к обилию особей, принадлежащих к определенному классу в выборке – ред.) в контрольной и СД2-группах, было одинаковым и немного выше в группе пациентов с ожирением, как видно на рисунке 1a. Однако эти различия не были статистически значимыми (p> 0,05), как другие параметры, такие как индекс Шеннона, филогенетическое разнообразие (PD) всего дерева и наблюдаемые OTUs, как показано на рисунке 1b – d.

 Альфа-разнообразие

Рисунок 1. Альфа-разнообразие выражается в: (a) Chao1, (b) индексе Шеннона, (c) наблюдаемых OUTs, (d) PD всего дерева. PD: филогенетическое разнообразие.

Бета-разнообразие (взвешенное и невзвешенное расстояние UniFrac) также было сходным между группами лечения и контроля, Рисунок 2a, b. В каждой из проанализированных групп как параметрические, так и непараметрические тестовые значения были одинаковыми и не были статистически значимыми (р> 0,05).

 Бета-разнообразие

Рисунок 2. Бета-разнообразие, выраженное в: а) взвешенном UniFrac и b) невзвешенном UniFrac.

Из-за большого числа таксонов от уровня L3 до уровня L7 описание, содержащееся в тексте, относится только к нескольким статистически значимым наблюдениям. Те таксоны, доля которых во всех 3 исследуемых группах была ниже 1%, были отнесены к категории прочие.

Все последовательности, полученные из изолятов биоптатов двенадцатиперстной кишки, были отнесены к 7 филогенетическим типам, как показано на рис. 3. Как в группе лечения, так и в контрольной группе преобладали бактерии, принадлежащие к двум типам - Firmicutes и Proteobacteria. После них значительный относительный процент принадлежал к типу актинобактерий. Другие типы были найдены в гораздо меньших или следовых количествах.

 Бактериальные профили в группе лечения и контрольной группе на уровне типа

Рисунок 3. Бактериальные профили в группе лечения и контрольной группе на уровне типа. Т2Д: сахарный диабет 2 типа.

После нормализации данных в анализируемых группах сравнивали вышеуказанные бактериальные типы, как показано на Рис. 1. Статистически значимые различия между группами с ожирением и контрольной группой наблюдались по отношению к типам Актинобактерий (pFDR = 0,019) и Бактериоидет (pFDR = 0,007). В группе СД2 процент бактерий, относящихся к типу Bacteroidetes, был статистически значимо выше, чем в контрольной группе (pFDR = 0,015).

В группе СД2 выявлена повышенная относительная распространенность класса Гаммапротеобактерий (Gammaproteobacteria) (20,02%) по отношению к тучной (6,68%) и контрольной (7,93%) группам. Эти различия были особенно заметны на уровне порядка, где относительное обилие энтеробактерий было почти в четыре раза выше, чем в контрольной группе (18,48% против 4,86%, pFDR = 0,087) и более чем в шесть раз выше, чем в группе с ожирением (18,48% против 2,83%, pFDR = 0,028), как показано на Рис.4.

 Бактериальные профили в группах обработки и контроля на уровне порядка

Рисунок 4. Бактериальные профили в группах обработки и контроля на уровне порядка.

На уровне рода в группе с ожирением наблюдался достоверно более высокий, но статистически незначимый процент представителей рода Staphylococcus по сравнению с другими группами лечения (12,61% против 0,87% в контроле и 0,99% в группе с ожирением). В группе СД2 аналогичная, но также статистически незначимая тенденция к росту наблюдалась для бактерий родов Lactobacillus (8,62% против 0,58% в контроле и 2,61% при ожирении) и Escherichia (18,42% против 4,84% в контроле и 2,83% при ожирении). Контрольная группа имела отличительный и статистически значимый процент представителей рода Bifidobacterium (5,47% против 0,28% ожирения и 0,69% СД2), (pFDR = 0,009), как показано на Рис.5.

 Бактериальные профили в группах обработки и контроля на уровне рода

Рисунок 5. Бактериальные профили в группах обработки и контроля на уровне рода.

Эти отношения также присутствовали на более высоких таксономических уровнях (семейство Bifidobacteriaceae и отряд Bifidobacteriales: 5,49% против 0,29% ожирения и 0,69% T2D, pFDR = 0,002; класс Actinobacteria: 20,31% против 11,45% ожирения и 14,90% T2D, pFDR = 0,057). Дальнейший анализ позволил выделить в контрольной группе четыре вида этого вида: Bifidobacterium animalis (5,20%), Bifidobacterium adolescentis (0,15%), Bifidobacterium longum (0,10%) и Bifidobacterium bifidum (0,02%).

3.3. Корреляционный анализ

В контрольной группе была обнаружена статистически значимая положительная корреляция между концентрацией ЛПВП и лактобактериями (Pearson, r = 0,64, pFDR = 0,007) и отрицательная корреляция между этими бактериями и LDL (Pearson, r = 0,57, pFDR = 0,003), рисунок 6а, б.

В группе пациентов с ожирением количество лактококков положительно коррелировало с концентрацией ЛПВП (Pearson, r = 0,83, pFDR <0,001), рис. 6c.

В группе T2D наблюдалась положительная корреляция между бактериями Bifidobacterium и концентрацией ЛПВП (Pearson, r = 0,87, pFDR <0,001), рис. 6d.

Корреляционный анализ

Рисунок 6. Корреляционный анализ: () положительная корреляция между концентрацией HDL и лактобацилл, (b) отрицательная корреляция между лактобациллами и LDL, c) положительная корреляция между концентрацией HDL и лактококком и (d) положительная корреляция между концентрацией бифидобактерий и HDL. HDL (ЛПВП): липопротеины высокой плотности LDL (ЛПНП): липопротеины низкой плотности

Статистически значимых корреляций для остальных параметров не наблюдалось.

4. Обсуждение

В данной работе мы сосредоточились на отдельных результатах метагеномного анализа микробиоты двенадцатиперстной кишки при сахарном диабете в сочетании с ожирением и у пациентов с ожирением (без диабета) по отношению к здоровым людям.

При анализе биоразнообразия (как альфа -, так и бета-разнообразия) в исследуемых группах выявлено отсутствие статистически значимых различий. Эти результаты свидетельствуют о существенном сходстве дуоденальной микробиоты, что может свидетельствовать о значительной доле общих бактерий, образующих ядро  микробиоты двенадцатиперстной кишки.

В исследуемом материале потенциальными бактериями, которые можно было бы охарактеризовать как общее ядро дуоденальной микробиоты в группах здоровых и больных, были типы: Firmicutes, Proteobacteria и Actinobacteria. В работе Li et al., определенное доминирование наблюдалось по отношению к типам Firmicutes и Proteobacteria. Другие типы присутствовали в небольших количествах [4], что согласуется с результатами, представленными в данной работе. С другой стороны, Firmicutes и Actinobacteria были доминирующими типами в исследованиях Angelakis et al. в обеих группах и протеобактерии составляли значительно меньший процент (9,5% в контрольной группе и 4% в группе больных ожирением) [9]. Эти диспропорции могут быть вызваны малочисленностью, т.е. 5 человек на группу. Тем не менее, другие исследования показали, что структура микробиоты в пределах одного и того же участка может существенно отличаться в зависимости от типа собранного материала. Например, в образцах желудочной жидкости наибольший процент составляли Firmicutes, Bacteroidetes и Actinobacteria, а в слизистой оболочке желудка - Proteobacteria и Firmicutes [12]. Что касается вышеуказанных результатов, то преобладание Firmicutes и Proteobacteria в биопсиях слизистой оболочки двенадцатиперстной кишки пациентов представляется оправданным, поскольку эта проксимальная часть тонкой кишки является другим сегментом пищеварительного тракта, отделенным от желудка только привратником желудка. В остальных отделах кишечника, особенно в толстой кишке, содержание протеобактерий уменьшается и заменяется значительной долей бактероидетов [12].

Согласно литературным данным, протеобактерии связаны с негативным воздействием на здоровье человека, главным образом из-за наличия в клеточной стенке эндотоксина, то есть липосахарида (ЛПС) [13]. В нашей работе в рамках данного типа обращал на себя внимание высокий процент класса Гаммапротеобактерий (Gammaproteobacteria) в группе больных Т2Д (20,02% против 7,93% в контроле и 6,68% при ожирении). Аналогичные результаты были получены в работе Мрозинской и др. [14]. Преобладание этой группы может быть связано с приемом метформина, обычно используемого пациентами при лечении сахарного диабета 2 типа. Ряд исследований показал, что применение некоторых лекарственных препаратов, в том числе метформина, связано с увеличением количества нескольких видов бактерий, относящихся к классу Гаммапротеобактерий: энтеробактерий, эшерихий, клебсиелл, цитробактерий, сальмонелл и протеев [15]. Эти результаты согласуются с несколькими крупными наблюдательными и интервенционными исследованиями, а также с родом Escherichia (18,42% против 4,84% контроля и 2,83% ожирения) в нашей работе. Результаты вышеупомянутых исследований усиливают аргументы в пользу теории бактериальной транслокации в ткани и, следовательно, уменьшения их обилия в толстой кишке [13]. Однако эти изменения могут быть отменены в результате лечения пробиотическим штаммом Bifidobacterium animalis subsp. lactis 420 (B420), который в исследованиях на мышах, проведенных группой под руководством доктора Амара, вызвал снижение адгезии бактерий из семейства Enterobacteriaceae (принадлежащих к типу Proteobacteria) к слизистой оболочке кишечника и уменьшение транслокации. В результате воспаление жировой ткани нормализовалось [16]. Не менее многообещающие результаты были получены в работах Stenman et al. [17,18]. Применение Bifidobacterium animalis subsp. lactis приводил к потере веса и уменьшению накопления жира, а также улучшал толерантность к глюкозе у мышей на богатой жирами диете [17,18].

Как и в упомянутых выше исследованиях, была также подтверждена ограниченная бактериальная адгезия к слизистой оболочке кишечника, а также снижение уровня ЛПС [17]. Другие исследования показали, что применение метформина в комбинации с B420 может принести гораздо лучшие результаты в лечении диабета, т. е. улучшить гликемический контроль и чувствительность к инсулину [19].

Эти результаты представляют собой еще один весомый аргумент в пользу использования Bifidobacterium animalis для снижения метаболической эндотоксемии и разработки терапевтической стратегии, основанной на контроле бактериальной транслокации и дисбиоза слизистой оболочки при сахарном диабете 2 типа, ассоциированном с ожирением или метаболическим синдромом [16]. На сегодняшний день в доступной литературе было найдено только одно исследование, которое проводило клинические исследования на людях по воздействию Bifidobacterium animalis ssp. lactis 420. После приема В420 группа добровольцев с избыточным весом и ожирением продемонстрировала снижение массы тела и жира по сравнению с группой плацебо [18]. С другой стороны, в фундаментальных исследованиях, проведенных на образцах кала у лиц с ожирением, избыточным весом, худобой и анорексией, было отмечено, что количество Bifidobacterium animalis было значительно выше в группе худых по сравнению с группой тучных [20]. Аналогичные результаты получены и в отношении общего числа бифидобактерий в исследованиях у больных сахарным диабетом 2 типа [20].

Приведенные выше данные основаны исключительно на исследованиях толстой кишки и ее содержимого. Ни одна из ранее опубликованных работ не освещает эти взаимосвязи в других отделах пищеварительного тракта. Однако эти изменения уже можно наблюдать в слизистой оболочке двенадцатиперстной кишки. На это указывают результаты, полученные в настоящей работе, в которых процент бифидобактерий был достоверно выше в контрольной группе (5,47%) по сравнению с процентами у больных с ожирением (0,28%) и с сахарным диабетом 2 типа и ожирением (0,69%), как показано на Рис.5. На видовом уровне эта связь не была статистически значимой, что, вероятно, указывает на то, что не только Bifidobacterium animalis, но и другие виды внутри рода Bifidobacterium (например, B. adolescentis, B. longum и B. bifidum) могут совместно оказывать эффект, заметный на более высоких уровнях. Особо следует отметить демонстрацию положительной и сильной связи (r = 0,87, p < 0,001), рис.6d между родом бифидобактерий и концентрацией ЛПВП в группе больных сахарным диабетом 2 типа и ожирением.

В работе Salamon et al., после секвенирования изолятов из образцов стула, аналогичная взаимосвязь, но средней тяжести, наблюдалась у обоих пациентов с сахарным диабетом 1-го типа (r = 0,46; p = 0,03) и 2-го типа (r = 0,43; p = 0,03) [21]. Эти наблюдения подтверждают связь между родом бифидобактерий и концентрацией ЛПВП в исследованиях на животных [22-24]. Собранные к настоящему времени результаты исследований свидетельствуют о значительной роли рода Bifidobacterium в функционировании кишечной микробиоты, как в дистальном, так и в проксимальном отделах. Более того, эти бактерии могут рассматриваться в контексте потенциального маркера дисбактериоза кишечника. Следующий шаг в будущем должен включать повторное исследование с большим количеством пациентов. При повторном выявлении описанных выше взаимосвязей в качестве терапевтической цели следует определить оптимальный для поддержания гомеостаза диапазон бифидобактерий.

Аналогичная связь в отношении ЛПВП, но у пациентов с ожирением была обнаружена для неизвестных видов, принадлежащих к роду Lactococcus (r = 0,83; р <0,001), рис. 6c. Соответствующие литературные данные относятся в первую очередь к бактериям с пробиотическими свойствами, таким как Lactococcus lactis [25–27]. Один обзор, процитированный во многих исследованиях, включал отобранные штаммы Lactococcus lactis [27]. Например, на основе многолетних наблюдений in vitro были предложены два механизма действия L. lactis, состоящие из адгезии и ассимиляции холестерина, что, следовательно, приводит к его снижению в среде. В свою очередь, в исследованиях in vivo, проведенных на крысах, администрация двух штаммов Lactococcus lactis subsp. lactis biovar diacetylactis N7 и Lactococcus lactis subsp. lactis 527 снижал общий холестерин и триглицериды в сыворотке, а также увеличивал фракцию ЛПВП по сравнению с общим холестерином [27]. В дополнение к родам Lactococcus и Bifidobacterium, описанным ранее, бактерии Lactobacillus также классифицируются как пробиотики, которые оказывают благотворное влияние на здоровье человека, включая поддержание гомеостаза в кишечнике, ингибирование воспалительных реакций и перемещение бактерий из кишечника. Корреляционный анализ в контрольной группе этого исследования показал положительное влияние порядка Lactobacillales на концентрацию ЛПВП и уменьшение этих бактерий, наряду с увеличением концентрации ЛПНП, рис. 6a, b. Однако в некоторых сообщениях результаты мета-анализа указывают на то, что бактерии рода Lactobacillus, помимо их благотворного влияния, также оказывают влияние на увеличение массы тела [28], что можно рассматривать в контексте результатов, полученных в настоящей работе, в которой наблюдалась тенденция к увеличению числа бактерий рода Lactobacillus в группе больных ожирением (2,61%) и у больных сахарным диабетом 2 типа и ожирением (8,62%) по сравнению со здоровыми людьми (0,58%). Не менее интересные наблюдения, подтвержденные до сих пор на животной модели, наблюдались в отношении вида Lactobacillus salivarius. L. salivarius продуцирует бактериоцины, которые увеличивают количество Bacteroidetes и Proteobacteria  и снижают концентрацию Actinobacteria [29]. Эти результаты могут объяснить статистически значимое увеличение Бактериоидетов, тенденцию к росту Протеобактерий и, в то же время, статистически значимое снижение Актинобактерий в группе пациентов с ожирением, а также с сахарным диабетом 2 типа и ожирением.

Точный механизм действия этих бактерий в условиях сахарного диабета 2 типа и ожирения до конца не изучен. Однако современные знания и результаты нашей работы поддерживают следующий описанный путь. Несомненно, одним из важных факторов, инициирующих каскад происходящих в организме изменений, является чрезмерное и длительное употребление рациона, богатого жирами и сахарами, что приводит к снижению обилия бифидобактерий при одновременном повышении уровня глюкозы натощак и общего холестерина [30]. Бактерии из рода Bifidobacterium участвуют, в частности, в ингибировании адгезии патогенов к слизистой оболочке кишечника [31]. В случае их дефицита создаются благоприятные условия для колонизации кишечника бактериями, принадлежащими к типу Proteobacteria (представленному в данном исследовании в группе больных СД2 классом Gammaproteobacteria, порядком Enerobaceriales и родом Escherichia) и Bacteroidetes (представленному в нашем исследовании в значительно большем количестве по сравнению с контрольной группой), которые высвобождают вышеупомянутые ЛПС (липополисахариды) в кровоток. Роль ЛПС заключается в индуцировании и усилении продукции провоспалительных цитокинов, что в свою очередь приводит к ослаблению стянутости кишечной стенки. В результате бактериальные антигены проникают в кровоток и органы, инициируя субклиническое воспаление. По мере увеличения количества ЛПС, циркулирующего в организме, увеличивается также концентрация триглицеридов и глюкозы. Эти эффекты способствуют развитию ожирения и инсулинорезистентности, что в дальнейшем приводит к развитию сахарного диабета 2 типа [32]. Таким образом, уменьшение количества бифидобактерий в двенадцатиперстной кишке и описанные выше процессы могут быть инициирующим фактором для дальнейших патогенных изменений в последующих отделах кишечника при прогрессировании этих заболеваний.

Ограничением данного исследования было небольшое количество пациентов в группе лечения и контрольной группе. Кроме того, в исследовании отсутствовала третья группа лечения, в которую входили бы пациенты с сахарным диабетом 2 типа без ожирения. Трудно найти таких пациентов, особенно когда необходимо было соответствовать критериям включения, описанным выше.

5. Выводы

Это исследование продемонстрировало, что у пациентов с диабетом и ожирением имеется общая микробиота ядра в двенадцатиперстной кишке на уровне типа, состоящая из Firmicutes, Actinobacteria и Proteobacteria. В пределах типа Actinobacteria относительная численность рода Bifidobacterium была значительно ниже как в группе с ожирением, так и в группе диабета по сравнению с контрольной группой. Наблюдение этих изменений также на более высоких таксономических уровнях может инициировать патогенный эффект, который усиливается в более дальних отделах кишечника. Таким образом, род Bifidobacterium следует рассматривать в будущем в контексте потенциального биомаркера в развитии как диабета 2 типа, так и ожирения.

См. также: Микробиом кишечника и СД 2-го типа: обсуждение сложных отношений

Литература

  1. World Health Organization Home Page. Available online: https://apps.who.int/iris/bitstream/handle/10665/204871/9789241565257_eng.pdf; (accessed on 18 December 2019).
  2. International Diabetes Federation Home Page. Available online: https://www.idf.org/elibrary/epidemiology‐research/diabetes‐atlas/13‐diabe‐atlas‐seventh‐edition.html (accessed on 18 December 2019).
  3. 3.      Wang, Z.‐K.; Yang, Y.‐S. Upper gastrointestinal microbiota and digestive diseases. World J. Gastroenterol. 2013, 19, 1541–1550.
  4. Li, G.; Yang, M.; Zhou, K.; Zhang, L.; Tian, L.; Lv, S.; Jin, Y.; Qian, W.; Xiong, H.; Lin, R.; et al. Diversity of Duodenal and Rectal Microbiota in Biopsy Tissues and Luminal Contents in Healthy Volunteers. J. Microbiol. Biotechnol. 2015, 25, 1136–1145.
  5. Sender, R.; Fuchs, S.; Milo, R. Revised estimates for the number of human and bacteria cells in the body. PLOS Biology 2016, 14, 036103.
  6. Di Cagno, R.; De Angelis, M.; De Pasquale, I.; Ndagijimana, M.; Vernocchi, P.; Ricciuti, P.; Gagliardi, F.; Laghi, L.; Crecchio, C.; Guerzoni, M.E.; et al. Duodenal and faecal microbiota of celiac children: molecular, phenotype and metabolome characterization. BMC Microbiol. 2011, 11, 219.
  7. Sánchez, E.; Donat, E.; Ribes‐Koninckx, C.; Fernández‐Murga, M.L.; Sanz, Y. Duodenal‐Mucosal Bacteria Associated with Celiac Disease in Children. Appl. Environ. Microbiol. 2013, 79, 5472–5479.
  8. Schippa, S.; Iebba, V.; Barbato, M.; Di Nardo, G.; Totino, V.; Checchi, M.P.; Longhi, C.; Maiella, G.; Cucchiara, S.; Conte, M.P. A distinctive ’microbial signature’ in celiac pediatric patients. BMC Microbiol. 2010, 10, 175.
  9. Angelakis, E.; Armougom, F.; Carrière, F.; Bachar, D.; Laugier, R.; Lagier, J.‐C.; Robert, C.; Michelle, C.; Henrissat, B.; Raoult, D. A Metagenomic Investigation of the Duodenal Microbiota Reveals Links with Obesity. PLOS ONE 2015, 10, e0137784.
  10. Gosiewski, T.; Szała, L.; Pietrzyk, A.; Brzychczy‐Włoch, M.; Heczko, P.B.; Bulanda, M.; Comparison of Methods for Isolation of Bacterial and Fungal DNA from Human Blood. Curr. Microbiol. 2014, 68, 149–155.
  11. Caporaso, J.G.; Kuczynski, J.; Stombaugh, J.; Bittinger, K.; Bushman, F.D.; Costello, E.K.; Fierer, N.; Peña, A.G.; Goodrich, J.K.; I Gordon, J.; et al. QIIME allows analysis of high‐throughput community sequencing data. Nat. Methods 2010, 7, 335–6.
  12. Bik, E.M.; Eckburg, P.B.; Gill, S.R.; Nelson, K.E.; Purdom, E.A.; Francois, F.; Perez, G.P.; Blaser, M.J.; Relman, D.A. Molecular analysis of the bacterial microbiota in the human stomach. In Proceedings of the Proceedings of the National Academy of Sciences; Proceedings of the National Academy of Sciences, 2006; Vol. 103, pp. 732–737.
  13. Pussinen, P.J.; Havulinna, A.S.; Lehto, M.; Sundvall, J.; Salomaa, V. Endotoxemia Is Associated With an Increased Risk of Incident Diabetes. Diabetes Care 2011, 34, 392–397.
  14. Mrozinska, S.; Radkowski, P.; Gosiewski, T.; Szopa, M.; Bulanda, M.; Ludwig‐Galezowska, A.H.; Morawska, I.; Sroka‐Oleksiak, A.; Matejko, B.; Kapusta, P.; et al. Qualitative Parameters of the Colonic Flora in Patients with HNF1A‐MODY Are Different from Those Observed in Type 2 Diabetes Mellitus. J. Diabetes Res. 2016, 2016, 1–9.
  15. Le Bastard, Q.; Al‐Ghalith, G.A.; Grégoire, M.; Chapelet, G.; Javaudin, F.;  Dailly, E.; Batard, E.; Knights, D.; Montassier, E.; e t al. Systematic review: human gut dysbiosis induced by non‐antibiotic prescription medications. Aliment. Pharmacol. Ther. 2018, 47, 332–345.
  16. Amar, J.; Chabo, C.; Waget, A.; Klopp, P.; Vachoux, C.; Bermúdez‐Humarán, L.G.; Smirnova, N.; Bergé, M.; Sulpice, T.; Lahtinen, S.; et al. Intestinal mucosal adherence and translocation of commensal bacteria at the early onset of type 2 diabetes: molecular mechanisms and probiotic treatment: Bacterial translocation during diabetes. EMBO Mol. Med. 2011, 3, 559–572.
  17. Stenman, L.K.; Waget, A.; Garret, C.; Klopp, P.; Burcelin, R.; Lehinen, M.J. Potential probiotic Bifidobacterium animalis ssp. lactis 420 prevents weight gain and glucose intolerance in diet‐induced obese mice. Benef. Microbes, 2014, 5, 437–445.
  18. Stenman, L.K.; Lehtinen, M.J.; Meland, N.; Christensen, J.E.; Yeung, N.; Saarinen, M.T.; Courtney, M.; Burcelin, R.; Lähdeaho, M.‐L.; Linros, J.; et al. Probiotic with or without Fiber Controls Body Fat Mass, Associated With Serum Zonulin, in Overweight and Obese Adults—Randomized Controlled Trial. EBioMedicine 2016, 13, 190–200.
  19. Stenman, L.K.; Waget, A.; Garret, C.; Briand, F.; Burcelin, R.; Sulpice, T.; Lahtinen, S. Probiotic B420 and prebiotic polydextrose improve efficacy of antidiabetic drugs in mice. Diabetol. Metab. Syndr. 2015, 7, 75.
  20. Schwiertz, A.; Taras, D.; Schafer, K.; Beijer, S.; Bos, N.A.; Donus, C.; Hardt, P.D. Microbiota and SCFA in Lean and Overweight Healthy Subjects. Obes. 2010, 18, 190–195.
  21. Salamon, D.; Sroka, A.; Kapusta, P.; Szopa, M.; Mrozińska, S.; Ludwig, A.H.; Wołkow, P.P.; Bulanda, M.; Klupa, T.; Małecki, M.T.; e t al. Characteristics of gut microbiota in adult patients with type 1 and type 2 diabetes based on next‐generation sequencing of the 16S rRNA gene fragment. Pol. Arch. Intern. Med. 2018, 128, 6.
  22. An, H.M.; Park, S.Y.; Lee, D.K.; Kim, J.R.; Cha, M.K.; Lee, S.W.; Lim, H.T.; Kim, K.J.; Ha, N.J. Antiobesity and lipid‐lowering effects of Bifidobacterium spp. in high fat diet‐induced obese rats. Lipids Heal. Dis. 2011, 10, 116.
  23. Ichim, T.E.; Patel, A.N.; Shafer, K.A. Experimental support for the effects of a probiotic/digestive enzyme supplement on serum cholesterol concentrations and the intestinal microbiome. J. Transl. Med. 2016, 14, 184.
  24. Kießling, G.; Schneider, J.; Jahreis, G. Long‐term consumption of fermented dairy products over 6 months increases HDL cholesterol. Eur. J. Clin. Nutr. 2002, 56, 843–849.
  25. 25.  Hassanein, W.A.; Awny, N.M.; Ibraheim, S.M. Cholesterol reduction by Lactococcus lactis KF147. Afr J Microbiol Res. 2013, 7, 4338–4349.
  26. Lee, W.‐K.; Lim, H.‐J.; Kim, S.‐Y.; Kimoto, H.; Ohmomo, S.; Tashiro, Y.; Takebe, H. Hypocholesterolemic Effect of Lactococcus lactis subsp. lactis biovar diacetylactis N7 and Lactococcus lactis subsp. lactis 527 Strains in SD Rats. Biosci. Microflora 2005, 24, 11–16.
  27. Yadav, K.; Bhardwaj, A.; Kaur, G.; Iyer, R; De, S; Malik, R.K. Potential of Lactococcus lactis as a probiotic and functional lactic acid bacteria in dairy industry. Int. J. Probiotics Prebiotics. 2009, 4, 219–228.
  28. Angelakis, E.; Merhej, V.; Raoult, D. Related actions of probiotics and antibiotics on gut microbiota and weight modification. Lancet Infect. Dis. 2013, 13, 889–899.
  29. Murphy, E.F.; Cotter, P.D.; Hogan, A.; OʹSullivan, O.; Joyce, A.; Fouhy, F.;  Clarke, S.F.; Marques, T.M.; OʹToole, P.W.; Stanton, C.; et al. Divergent metabolic outcomes arising from targeted manipulation of the gut microbiota in diet‐induced obesity. Gut. 2013, 62, 220 –226.
  30. Singh, R.K.; Chang, H.‐W.; Yan, D.; Lee, K.M.; Ucmak, D.; Wong, K.; Abrouk, M.; Farahnik, B.; Nakamura, M.; Zhu, T.H.; et al. Influence of diet on the gut microbiome and implications for human health. J. Transl. Med. 2017, 15, 73.
  31. Monteagudo‐Mera, A.; Rastall, R.A.; Gibson, G.R.; Charalampopoulos, D.;  Chatzifragkou, A. Adhesion mechanisms mediated by probiotics and prebiotics and their potential impact on human health. Appl. Microbiol. Biotechnol. 2019, 103, 6463–6472.
  32. Marlicz, W.; Ostrowska, L.; Łoniewski, I. Intestinal microbiota and its  potential relationship with obesity. Endokrynol. Otył. Zab. Przem. Mat 2013, 9, 20‐28.

Будьте здоровы!

 

ССЫЛКИ К РАЗДЕЛУ О ПРЕПАРАТАХ ПРОБИОТИКАХ

  1. ПРОБИОТИКИ
  2. ДОМАШНИЕ ЗАКВАСКИ
  3. БИФИКАРДИО
  4. КОНЦЕНТРАТ БИФИДОБАКТЕРИЙ ЖИДКИЙ
  5. ПРОПИОНИКС
  6. ЙОДПРОПИОНИКС
  7. СЕЛЕНПРОПИОНИКС
  8. МИКРОЭЛЕМЕНТНЫЙ СОСТАВ
  9. ПРОБИОТИКИ С ПНЖК
  10. БИФИДОБАКТЕРИИ
  11. ПРОПИОНОВОКИСЛЫЕ БАКТЕРИИ
  12. ПРОБИОТИКИ И ПРЕБИОТИКИ
  13. СИНБИОТИКИ
  14. РОЛЬ МИКРОБИОМА В ТЕРАПИИ РАКА
  15. АНТИОКСИДАНТНЫЕ СВОЙСТВА
  16. АНТИОКСИДАНТНЫЕ ФЕРМЕНТЫ
  17. АНТИМУТАГЕННАЯ АКТИВНОСТЬ
  18. МИКРОФЛОРА КИШЕЧНОГО ТРАКТА
  19. МИКРОБИОМ ЧЕЛОВЕКА
  20. МИКРОФЛОРА И ФУНКЦИИ МОЗГА
  21. ПРОБИОТИКИ И ХОЛЕСТЕРИН
  22. ПРОБИОТИКИ ПРОТИВ ОЖИРЕНИЯ
  23. МИКРОФЛОРА И САХАРНЫЙ ДИАБЕТ
  24. ПРОБИОТИКИ и ИММУНИТЕТ
  25. МИКРОБИОМ И АУТОИММУННЫЕ БОЛЕЗНИ
  26. ПРОБИОТИКИ и ГРУДНЫЕ ДЕТИ
  27. ПРОБИОТИКИ, БЕРЕМЕННОСТЬ, РОДЫ
  28. ДИСБАКТЕРИОЗ
  29. ВИТАМИННЫЙ СИНТЕЗ
  30. АМИНОКИСЛОТНЫЙ СИНТЕЗ
  31. АНТИМИКРОБНЫЕ СВОЙСТВА
  32. СИНТЕЗ ЛЕТУЧИХ ЖИРНЫХ КИСЛОТ
  33. СИНТЕЗ БАКТЕРИОЦИНОВ
  34. ФУНКЦИОНАЛЬНОЕ ПИТАНИЕ
  35. АЛИМЕНТАРНЫЕ ЗАБОЛЕВАНИЯ
  36. ПРОБИОТИКИ ДЛЯ СПОРТСМЕНОВ
  37. ПРОИЗВОДСТВО ПРОБИОТИКОВ
  38. ЗАКВАСКИ ДЛЯ ПИЩЕВОЙ ПРОМЫШЛЕННОСТИ
  39. НОВОСТИ